ID: 960229653

View in Genome Browser
Species Human (GRCh38)
Location 3:115210201-115210223
Sequence GGCCATCAAAATAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960229653_960229658 13 Left 960229653 3:115210201-115210223 CCTCCCTCTTTATTTTGATGGCC No data
Right 960229658 3:115210237-115210259 AAGCCTTCTTATTTTTTGATGGG No data
960229653_960229657 12 Left 960229653 3:115210201-115210223 CCTCCCTCTTTATTTTGATGGCC No data
Right 960229657 3:115210236-115210258 CAAGCCTTCTTATTTTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960229653 Original CRISPR GGCCATCAAAATAAAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr