ID: 960230226

View in Genome Browser
Species Human (GRCh38)
Location 3:115217414-115217436
Sequence CAAAATAAAAAGATGTAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960230223_960230226 21 Left 960230223 3:115217370-115217392 CCACTATGCACAAGTGTTTGTAG No data
Right 960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG No data
960230222_960230226 22 Left 960230222 3:115217369-115217391 CCCACTATGCACAAGTGTTTGTA No data
Right 960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960230226 Original CRISPR CAAAATAAAAAGATGTAGCT CGG Intergenic
No off target data available for this crispr