ID: 960235677

View in Genome Browser
Species Human (GRCh38)
Location 3:115279477-115279499
Sequence AGGAATTAAACCCATGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960235673_960235677 3 Left 960235673 3:115279451-115279473 CCACAGTGACTTCGATCTCTTCA 0: 1
1: 1
2: 2
3: 16
4: 201
Right 960235677 3:115279477-115279499 AGGAATTAAACCCATGTGGGAGG No data
960235672_960235677 20 Left 960235672 3:115279434-115279456 CCAAAGGATCTGACAGGCCACAG 0: 1
1: 0
2: 1
3: 15
4: 204
Right 960235677 3:115279477-115279499 AGGAATTAAACCCATGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960235677 Original CRISPR AGGAATTAAACCCATGTGGG AGG Intergenic
No off target data available for this crispr