ID: 960235942

View in Genome Browser
Species Human (GRCh38)
Location 3:115282287-115282309
Sequence ACTCTTCCATGCTGAGAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960235942_960235945 4 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235945 3:115282314-115282336 TCAACCCAAACACACTGGGTTGG No data
960235942_960235950 23 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG No data
960235942_960235943 -1 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235943 3:115282309-115282331 TTGATTCAACCCAAACACACTGG No data
960235942_960235951 26 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235951 3:115282336-115282358 GGCTCCTGTGGAAAAACAGGAGG No data
960235942_960235946 5 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235946 3:115282315-115282337 CAACCCAAACACACTGGGTTGGG No data
960235942_960235949 14 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235949 3:115282324-115282346 CACACTGGGTTGGGCTCCTGTGG No data
960235942_960235944 0 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235944 3:115282310-115282332 TGATTCAACCCAAACACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960235942 Original CRISPR ACTCTTCCATGCTGAGAGAT TGG (reversed) Intergenic
No off target data available for this crispr