ID: 960235944

View in Genome Browser
Species Human (GRCh38)
Location 3:115282310-115282332
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960235940_960235944 22 Left 960235940 3:115282265-115282287 CCACTGAAGAGTCAAATGCATTC No data
Right 960235944 3:115282310-115282332 TGATTCAACCCAAACACACTGGG No data
960235942_960235944 0 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235944 3:115282310-115282332 TGATTCAACCCAAACACACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr