ID: 960235947

View in Genome Browser
Species Human (GRCh38)
Location 3:115282318-115282340
Sequence GAGCCCAACCCAGTGTGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960235947_960235950 -8 Left 960235947 3:115282318-115282340 CCCAAACACACTGGGTTGGGCTC No data
Right 960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG No data
960235947_960235951 -5 Left 960235947 3:115282318-115282340 CCCAAACACACTGGGTTGGGCTC No data
Right 960235951 3:115282336-115282358 GGCTCCTGTGGAAAAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960235947 Original CRISPR GAGCCCAACCCAGTGTGTTT GGG (reversed) Intergenic
No off target data available for this crispr