ID: 960235948

View in Genome Browser
Species Human (GRCh38)
Location 3:115282319-115282341
Sequence GGAGCCCAACCCAGTGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960235948_960235951 -6 Left 960235948 3:115282319-115282341 CCAAACACACTGGGTTGGGCTCC No data
Right 960235951 3:115282336-115282358 GGCTCCTGTGGAAAAACAGGAGG No data
960235948_960235950 -9 Left 960235948 3:115282319-115282341 CCAAACACACTGGGTTGGGCTCC No data
Right 960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960235948 Original CRISPR GGAGCCCAACCCAGTGTGTT TGG (reversed) Intergenic
No off target data available for this crispr