ID: 960235949

View in Genome Browser
Species Human (GRCh38)
Location 3:115282324-115282346
Sequence CACACTGGGTTGGGCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960235942_960235949 14 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235949 3:115282324-115282346 CACACTGGGTTGGGCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960235949 Original CRISPR CACACTGGGTTGGGCTCCTG TGG Intergenic
No off target data available for this crispr