ID: 960235950

View in Genome Browser
Species Human (GRCh38)
Location 3:115282333-115282355
Sequence TTGGGCTCCTGTGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960235947_960235950 -8 Left 960235947 3:115282318-115282340 CCCAAACACACTGGGTTGGGCTC No data
Right 960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG No data
960235948_960235950 -9 Left 960235948 3:115282319-115282341 CCAAACACACTGGGTTGGGCTCC No data
Right 960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG No data
960235942_960235950 23 Left 960235942 3:115282287-115282309 CCAATCTCTCAGCATGGAAGAGT No data
Right 960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960235950 Original CRISPR TTGGGCTCCTGTGGAAAAAC AGG Intergenic
No off target data available for this crispr