ID: 960237563

View in Genome Browser
Species Human (GRCh38)
Location 3:115301518-115301540
Sequence TGGGAGGATCGCTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102195
Summary {0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960237563_960237571 8 Left 960237563 3:115301518-115301540 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 960237571 3:115301549-115301571 ACATCAGTAGCTGGGACTACAGG No data
960237563_960237572 27 Left 960237563 3:115301518-115301540 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 960237572 3:115301568-115301590 CAGGTGTGTGCCACTGTGCCTGG 0: 85
1: 6457
2: 29745
3: 81557
4: 154160
960237563_960237567 -1 Left 960237563 3:115301518-115301540 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 960237567 3:115301540-115301562 ACCTCAACCACATCAGTAGCTGG No data
960237563_960237569 0 Left 960237563 3:115301518-115301540 CCTGGGCTTCAGCGATCCTCCCA 0: 9
1: 362
2: 5645
3: 30290
4: 65889
Right 960237569 3:115301541-115301563 CCTCAACCACATCAGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960237563 Original CRISPR TGGGAGGATCGCTGAAGCCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr