ID: 960245440

View in Genome Browser
Species Human (GRCh38)
Location 3:115394976-115394998
Sequence ATGGTGTTATGGAGAAAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960245438_960245440 -8 Left 960245438 3:115394961-115394983 CCTCACAGTAGTGTCATGGTGTT No data
Right 960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG No data
960245435_960245440 -1 Left 960245435 3:115394954-115394976 CCTCCTACCTCACAGTAGTGTCA No data
Right 960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG No data
960245433_960245440 11 Left 960245433 3:115394942-115394964 CCTAGTCCAAGGCCTCCTACCTC No data
Right 960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG No data
960245429_960245440 30 Left 960245429 3:115394923-115394945 CCCCGATCAAACTGTTGAACCTA No data
Right 960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG No data
960245431_960245440 28 Left 960245431 3:115394925-115394947 CCGATCAAACTGTTGAACCTAGT No data
Right 960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG No data
960245434_960245440 5 Left 960245434 3:115394948-115394970 CCAAGGCCTCCTACCTCACAGTA No data
Right 960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG No data
960245430_960245440 29 Left 960245430 3:115394924-115394946 CCCGATCAAACTGTTGAACCTAG No data
Right 960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG No data
960245436_960245440 -4 Left 960245436 3:115394957-115394979 CCTACCTCACAGTAGTGTCATGG No data
Right 960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960245440 Original CRISPR ATGGTGTTATGGAGAAAACA CGG Intergenic
No off target data available for this crispr