ID: 960246514

View in Genome Browser
Species Human (GRCh38)
Location 3:115405724-115405746
Sequence CTGCAGAGATGAAAACCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960246510_960246514 20 Left 960246510 3:115405681-115405703 CCTCAGGCAAATGGAGAAGAGTT No data
Right 960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG No data
960246509_960246514 21 Left 960246509 3:115405680-115405702 CCCTCAGGCAAATGGAGAAGAGT No data
Right 960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG No data
960246511_960246514 -10 Left 960246511 3:115405711-115405733 CCTTAATGCCAGCCTGCAGAGAT No data
Right 960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG No data
960246508_960246514 24 Left 960246508 3:115405677-115405699 CCTCCCTCAGGCAAATGGAGAAG No data
Right 960246514 3:115405724-115405746 CTGCAGAGATGAAAACCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960246514 Original CRISPR CTGCAGAGATGAAAACCAGA AGG Intergenic
No off target data available for this crispr