ID: 960252497

View in Genome Browser
Species Human (GRCh38)
Location 3:115471536-115471558
Sequence TAGGATGACATGTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960252488_960252497 30 Left 960252488 3:115471483-115471505 CCTCGAAAAATTATCTGTAAATG No data
Right 960252497 3:115471536-115471558 TAGGATGACATGTAGGAGGAGGG No data
960252491_960252497 1 Left 960252491 3:115471512-115471534 CCTAGGAAACCGAACTGACAAAA No data
Right 960252497 3:115471536-115471558 TAGGATGACATGTAGGAGGAGGG No data
960252493_960252497 -8 Left 960252493 3:115471521-115471543 CCGAACTGACAAAAATAGGATGA No data
Right 960252497 3:115471536-115471558 TAGGATGACATGTAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960252497 Original CRISPR TAGGATGACATGTAGGAGGA GGG Intergenic
No off target data available for this crispr