ID: 960253675

View in Genome Browser
Species Human (GRCh38)
Location 3:115487073-115487095
Sequence TCTCCAGGACTGCTGACGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960253675_960253679 12 Left 960253675 3:115487073-115487095 CCCTTCGTCAGCAGTCCTGGAGA No data
Right 960253679 3:115487108-115487130 GCTGCAGTGTCACAACTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960253675 Original CRISPR TCTCCAGGACTGCTGACGAA GGG (reversed) Intergenic
No off target data available for this crispr