ID: 960255346

View in Genome Browser
Species Human (GRCh38)
Location 3:115505719-115505741
Sequence GTCTCAAGGCTGCACATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960255346_960255354 21 Left 960255346 3:115505719-115505741 CCTGCTATGTGCAGCCTTGAGAC No data
Right 960255354 3:115505763-115505785 GCTCCAGCCATACCTAAATGGGG No data
960255346_960255352 19 Left 960255346 3:115505719-115505741 CCTGCTATGTGCAGCCTTGAGAC No data
Right 960255352 3:115505761-115505783 CTGCTCCAGCCATACCTAAATGG No data
960255346_960255353 20 Left 960255346 3:115505719-115505741 CCTGCTATGTGCAGCCTTGAGAC No data
Right 960255353 3:115505762-115505784 TGCTCCAGCCATACCTAAATGGG No data
960255346_960255349 -4 Left 960255346 3:115505719-115505741 CCTGCTATGTGCAGCCTTGAGAC No data
Right 960255349 3:115505738-115505760 AGACTTGGTGCTCTGCATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960255346 Original CRISPR GTCTCAAGGCTGCACATAGC AGG (reversed) Intergenic
No off target data available for this crispr