ID: 960257623

View in Genome Browser
Species Human (GRCh38)
Location 3:115527685-115527707
Sequence CTTTATTAGTAGTGTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960257618_960257623 7 Left 960257618 3:115527655-115527677 CCTTTGCAAATTACCCAGTCTCA No data
Right 960257623 3:115527685-115527707 CTTTATTAGTAGTGTGAAAATGG No data
960257621_960257623 -6 Left 960257621 3:115527668-115527690 CCCAGTCTCAGGGATGTCTTTAT 0: 24
1: 2926
2: 6368
3: 11056
4: 11668
Right 960257623 3:115527685-115527707 CTTTATTAGTAGTGTGAAAATGG No data
960257622_960257623 -7 Left 960257622 3:115527669-115527691 CCAGTCTCAGGGATGTCTTTATT 0: 9
1: 1172
2: 3772
3: 7344
4: 11290
Right 960257623 3:115527685-115527707 CTTTATTAGTAGTGTGAAAATGG No data
960257617_960257623 14 Left 960257617 3:115527648-115527670 CCTCTTTCCTTTGCAAATTACCC 0: 9
1: 345
2: 4692
3: 10803
4: 10356
Right 960257623 3:115527685-115527707 CTTTATTAGTAGTGTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960257623 Original CRISPR CTTTATTAGTAGTGTGAAAA TGG Intergenic
No off target data available for this crispr