ID: 960260108

View in Genome Browser
Species Human (GRCh38)
Location 3:115557658-115557680
Sequence CTGTGACCTCACATAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960260104_960260108 9 Left 960260104 3:115557626-115557648 CCTTTTCTGGTTCAGAGTCAGCT No data
Right 960260108 3:115557658-115557680 CTGTGACCTCACATAGTGGAAGG No data
960260103_960260108 10 Left 960260103 3:115557625-115557647 CCCTTTTCTGGTTCAGAGTCAGC No data
Right 960260108 3:115557658-115557680 CTGTGACCTCACATAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960260108 Original CRISPR CTGTGACCTCACATAGTGGA AGG Intergenic
No off target data available for this crispr