ID: 960260239

View in Genome Browser
Species Human (GRCh38)
Location 3:115559462-115559484
Sequence GGCAAGCTCCATGGTATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960260239_960260242 3 Left 960260239 3:115559462-115559484 CCTTGCATACCATGGAGCTTGCC No data
Right 960260242 3:115559488-115559510 TAGCATTTAAAAATATTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960260239 Original CRISPR GGCAAGCTCCATGGTATGCA AGG (reversed) Intergenic
No off target data available for this crispr