ID: 960261231

View in Genome Browser
Species Human (GRCh38)
Location 3:115570847-115570869
Sequence TGTTAACTATAGTCATCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960261231_960261233 9 Left 960261231 3:115570847-115570869 CCTTAAGATGACTATAGTTAACA No data
Right 960261233 3:115570879-115570901 AGTTTTGAATAACTAGAAGGAGG No data
960261231_960261232 6 Left 960261231 3:115570847-115570869 CCTTAAGATGACTATAGTTAACA No data
Right 960261232 3:115570876-115570898 CATAGTTTTGAATAACTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960261231 Original CRISPR TGTTAACTATAGTCATCTTA AGG (reversed) Intergenic
No off target data available for this crispr