ID: 960268354

View in Genome Browser
Species Human (GRCh38)
Location 3:115647289-115647311
Sequence TTTCTCACCATTCCAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1454
Summary {0: 1, 1: 1, 2: 24, 3: 238, 4: 1190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960268354 Original CRISPR TTTCTCACCATTCCAGAGGA TGG (reversed) Intronic
900467364 1:2832369-2832391 TTTCTAACCATTCTGGAGGCTGG - Intergenic
900768820 1:4524400-4524422 TTTCTCAACACACCAGAAGAGGG - Intergenic
900811202 1:4802510-4802532 TTTCTCACAGTTCCGGAGGCTGG - Intergenic
900823986 1:4911700-4911722 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
901276883 1:7998742-7998764 TGTCTCACCATTCTGGAGGCTGG + Intergenic
901908911 1:12438409-12438431 TTTCTCACAGTTCTGGAGGATGG - Intronic
902089230 1:13890063-13890085 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
902199268 1:14821729-14821751 TTTCTCACAATTCTGGAGGCTGG - Intronic
902422332 1:16290827-16290849 TTTCTCACAGTTCTAGAGGCTGG - Intronic
902456510 1:16537218-16537240 TTTCTCACAGTTCCGGAGGTTGG + Intergenic
902495655 1:16870693-16870715 TTTCTCACAGTTCCGGAGGTTGG - Intronic
903001795 1:20271485-20271507 TTTCTCACAATTCTGGAGGCTGG - Intergenic
903135780 1:21308427-21308449 TTACTCCCAATTCCAGAGAAGGG - Intronic
903150268 1:21403035-21403057 TTTCTCACAGTTCTGGAGGATGG + Intergenic
903495641 1:23765108-23765130 CTTCTCACAGTTCCAGAGGCTGG - Intergenic
904550418 1:31312086-31312108 TTTCTCACAATTCTGGAGGCTGG - Intronic
904933866 1:34112578-34112600 TTTGTCACCATGCCAGAGACTGG + Intronic
904988925 1:34575909-34575931 TTTCTCACAATTCTGGAGGCTGG - Intergenic
905082043 1:35331748-35331770 TTTCTCAGGATGCCAGAGTATGG - Intronic
905136812 1:35806895-35806917 TTTCTCACAATTCTGGAGGCTGG - Intergenic
905236022 1:36548838-36548860 TTTCTCACAGTTCCGGAGGCTGG - Intergenic
905336915 1:37251017-37251039 TTTCTCACCATTCTGTAGGCTGG - Intergenic
905858749 1:41332125-41332147 TTTCTCACAATTCTGGAGGCTGG + Intergenic
906745645 1:48220598-48220620 TTTCTCACAATTCTGGAGGCTGG + Intergenic
906898410 1:49805886-49805908 TTTCTCACAGTTCCAGAGGCTGG - Intronic
907052647 1:51340118-51340140 TTTCTCACAGTTCGGGAGGATGG - Intronic
907360915 1:53913931-53913953 TTTCTCACCACTCTGGAGGCTGG - Intergenic
907547128 1:55271841-55271863 TTTCTCACCGTTCTAGAGTCTGG - Intergenic
907713649 1:56907747-56907769 TATTTCTCCACTCCAGAGGATGG + Intronic
907791756 1:57673068-57673090 TTTCTCACATTTCTGGAGGATGG + Intronic
907801688 1:57772283-57772305 TTTCTCACAATTCTGGAGGCTGG - Intronic
908082951 1:60600119-60600141 TTTCTCACCATTCTGGAGGCTGG + Intergenic
908179663 1:61591420-61591442 TGTCTCACAGTTCCAGAGGCAGG + Intergenic
908245459 1:62224376-62224398 TTTCTCACCATTCTGGAGGCTGG - Intergenic
908742109 1:67339534-67339556 TTTATTACCATTCCTGAGGAAGG - Intronic
909131567 1:71743120-71743142 TTTCTCACAGTTTCAGAGGCTGG - Intronic
909353241 1:74677955-74677977 TTTCTCACTGTTCTAGAGGCTGG - Intergenic
909529832 1:76670105-76670127 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
909704663 1:78567132-78567154 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
909837355 1:80273765-80273787 TTTCTCACAGTTCTAGAGGTGGG - Intergenic
909983942 1:82137239-82137261 TTTCTCATAATTCGAGAGGCTGG + Intergenic
910159200 1:84255457-84255479 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
910442723 1:87269009-87269031 TTGCTCACAGTTCCAGAGGCTGG - Intergenic
910544570 1:88399123-88399145 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
910607221 1:89100251-89100273 TTTCTCACAGTTCTAGAGGGTGG - Intergenic
910840261 1:91554600-91554622 TTTCTCACAATTCTGGAGGCTGG + Intergenic
910927080 1:92408664-92408686 TTTCTCACCATTCTGGAGGCTGG - Intergenic
911003715 1:93195786-93195808 TTTCTCACAGTTCCGGAGGCTGG - Intronic
911229402 1:95344768-95344790 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
911366891 1:96949442-96949464 TTTATCACAGTTCCAGAGGCTGG + Intergenic
911378048 1:97075729-97075751 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
911386124 1:97177841-97177863 TTTCTCACCATTCTGGACGCTGG + Intronic
911480926 1:98439500-98439522 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
911537756 1:99120862-99120884 TTTCTCACAGTTCTAGAGGGTGG - Intergenic
911545398 1:99210072-99210094 TTTCTCATCATTCTGGAGGCTGG - Intergenic
911764246 1:101655136-101655158 TTTCTCACAGCTCCAGAGGTTGG - Intergenic
911854297 1:102857344-102857366 GTTCTCACACTTCTAGAGGATGG + Intergenic
912019886 1:105094675-105094697 TTTCTCATCATTACCCAGGAGGG - Intergenic
912131528 1:106608189-106608211 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
913168622 1:116212061-116212083 TTTCTCCCCATTCCAGGGCCTGG + Intergenic
913197609 1:116471003-116471025 TTTCTCACAATTCTGGAGGCTGG - Intergenic
913279821 1:117175033-117175055 TCTGTCTCCATTCCTGAGGAGGG + Intronic
914017595 1:143834606-143834628 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
914222948 1:145696627-145696649 TTTCTCATGATTCTAGAGGCTGG - Intronic
914395298 1:147261259-147261281 TTTATCACCGTTCTAGAGGCTGG + Intronic
914656206 1:149743138-149743160 TTTCTCACTGTTCTAGAGGCTGG + Intergenic
915653090 1:157333903-157333925 TTTCTCACAATACCGGAGGTTGG - Intergenic
915674528 1:157518036-157518058 TTTCTCACAATTCTGGAGGCTGG - Intronic
915811962 1:158922601-158922623 TTTCTCACAATTCTTGAGGTTGG - Intergenic
915826374 1:159082386-159082408 TTTCTCACAATTCTGGAGGCTGG + Intronic
916489987 1:165293659-165293681 TTTCTCACAATTCTGGAGGCTGG + Intronic
916554501 1:165882527-165882549 TTTCTCACAATTCCAGAGGCTGG + Intronic
916920104 1:169456753-169456775 TTTCTTACCATTCTGGAGGCTGG - Intronic
917481261 1:175414161-175414183 TTTCTCACCATTCTAGAAGCTGG - Intronic
917527454 1:175801681-175801703 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
917652676 1:177094581-177094603 CTTCTCACAGTTCCAGAGGCTGG - Intronic
917742361 1:177973004-177973026 TTTCTCACCCTTCTGGAGGCTGG - Intronic
917837691 1:178953946-178953968 TTTCTCACCTTTCCCCAGTAGGG + Intergenic
917919036 1:179734483-179734505 TTTCTCACCGTTCCATAAGCTGG + Intergenic
918334199 1:183491784-183491806 TTTCTCACAGATCCAGAGGCTGG + Intronic
918356959 1:183713729-183713751 TTTCTCACAGTTCTAGAGGCTGG - Intronic
918570524 1:185986384-185986406 AGTCTCATCTTTCCAGAGGATGG + Intronic
918636332 1:186779203-186779225 TTTCTCACAATTCTGGAGGGTGG + Intergenic
918656692 1:187035576-187035598 TTTCTCACAGTTCTAGAGGATGG + Intergenic
918937840 1:190947064-190947086 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
919349465 1:196431161-196431183 TTTCTCACAGTTCTAGAAGAAGG - Intronic
919440741 1:197630268-197630290 TTTCTCACCATTCTGGAGGCTGG + Intronic
919662761 1:200263371-200263393 TTTCTCACAGCTCCAGAGGCTGG - Intergenic
920158419 1:203975739-203975761 TTTCTTTCCCTTCCAGAGGAAGG - Intergenic
920243396 1:204570228-204570250 TTGCTCACAATTCTAGAGGCTGG + Intergenic
920446908 1:206024562-206024584 TTTCTCACTATTCTGGAGGCTGG + Intergenic
920844387 1:209581743-209581765 TTTCTCACCATTCTGGAGGCTGG + Intergenic
920845057 1:209586689-209586711 TTTCTCAGCATTCCTTTGGAGGG - Intronic
920867980 1:209769067-209769089 TCTCTCCCCATTCCATAGTATGG - Intronic
920933717 1:210411968-210411990 TTTCTCACAGTTCTAGAGGCTGG + Intronic
921124852 1:212168251-212168273 TTTCTCACCGTGCTAGAGGCTGG - Intergenic
921184326 1:212656776-212656798 TTCCTCACTATTCTAGAGGCTGG - Intergenic
921410322 1:214829597-214829619 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
921481023 1:215664871-215664893 TTTCCCACAATTCTAGAGGCGGG - Intronic
921588640 1:216978019-216978041 TTTCTCACAATTCTAGTGGCTGG - Intronic
921751253 1:218796596-218796618 TTTCTCACAGTCCCAGAGGCTGG + Intergenic
921826802 1:219681214-219681236 TTTCTCACAGTTCCAGAGACTGG + Intergenic
921874620 1:220180687-220180709 TTTCACAACATTGGAGAGGAGGG + Intronic
921914337 1:220590341-220590363 TTTCTCACCTTTCTAGAGTCTGG + Intronic
921982691 1:221275322-221275344 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
923000252 1:230001312-230001334 TTTTTCACAGTTCCAGAGGCTGG + Intergenic
923434846 1:233958048-233958070 TTCTTCACCATTCCAAAGGAAGG + Intronic
923676843 1:236087802-236087824 TTTTTCACCATTCTGGAGGCTGG + Intergenic
923738302 1:236632737-236632759 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
923785427 1:237063238-237063260 CTTCTCACCATTCTGGAGGCTGG - Intronic
924221697 1:241883319-241883341 TTTCTCACAGTTCTAGAGGCTGG + Intronic
924302660 1:242655303-242655325 TATCTCTCAATTACAGAGGATGG - Intergenic
924324129 1:242878271-242878293 TTTCTCACCCTTCTGGAGGTGGG - Intergenic
924634152 1:245768873-245768895 TTTCTCACAGTTCCGGAGGCTGG - Intronic
924848321 1:247795829-247795851 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1062964665 10:1598222-1598244 CTGCTCACAATTCCAGAGGTGGG + Intronic
1062964678 10:1598273-1598295 CTGCTCACAATTCCAGAGGTGGG + Intronic
1062964689 10:1598324-1598346 CTGCTCACAATTCCAGAGGTGGG + Intronic
1063023883 10:2158219-2158241 TTTCTCACCATTCTGGAGTCTGG - Intergenic
1063286480 10:4694170-4694192 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1063345050 10:5303838-5303860 TTTCTCAACATTCTGGAGGCTGG - Intergenic
1063356065 10:5399503-5399525 TTTCTCACGATTCTGGAGGCTGG - Intronic
1063434045 10:6016318-6016340 TTTCTTACCATTCTGGAGGCTGG - Intronic
1063512106 10:6655676-6655698 TTTCTCACTATTCTAGAGTCTGG + Intergenic
1063514658 10:6683640-6683662 TTTCTGACAGTTCCAGAGGCTGG - Intergenic
1063615997 10:7600934-7600956 TTTCTCACAGTTCTAGAGGTTGG - Intronic
1063620529 10:7643234-7643256 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1063802942 10:9602294-9602316 TTTATTACAGTTCCAGAGGATGG - Intergenic
1063857235 10:10268904-10268926 TTTCTCAACATTCTGGAGGCTGG + Intergenic
1063882867 10:10549222-10549244 TTCCTCACCATTCTGGAGGCAGG + Intergenic
1064017619 10:11784805-11784827 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1064218765 10:13421689-13421711 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1064350406 10:14571023-14571045 TTTCTCACAATTCTAGAGGCTGG + Intronic
1064358473 10:14641484-14641506 TTTCTCAGAGTTCCAGAGGCTGG + Intronic
1064463984 10:15561709-15561731 TTTCTAACACTTCCAGAGAAAGG - Intronic
1065068746 10:22000870-22000892 TTTCTCACAATTCTGGAGGCTGG - Intronic
1065492489 10:26296034-26296056 TTTCTCACTGTTCTAGAGGCGGG + Intronic
1065644966 10:27824513-27824535 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1065718152 10:28594053-28594075 TTTGTCACCCTCCCAGAGGGTGG - Intronic
1066587086 10:36947421-36947443 TTTCTCATGATTCCGGAGGCTGG - Intergenic
1067221214 10:44345691-44345713 TTTCTCACAGTTCTAGAGGTTGG + Intergenic
1067423473 10:46180628-46180650 GTTCTCACAGTTCCAGAGGCTGG - Intergenic
1067443495 10:46326475-46326497 CTTCTAACCATGCCAGAAGAGGG + Intronic
1067534748 10:47100759-47100781 TTTTTCACAGTTCCAGAGGCTGG - Intergenic
1067743943 10:48919537-48919559 TCTCTCACTGTTCCAGAGGCTGG + Intronic
1067808041 10:49406845-49406867 TGTCTCACCACCCAAGAGGATGG - Intergenic
1067895339 10:50173631-50173653 TCCCTCTCCATTCCAGAGAATGG + Intergenic
1067953648 10:50768347-50768369 TCCCTCTCCATTCCAGAGAATGG - Intronic
1068234008 10:54208623-54208645 TTTCTCACTCTTCCGGAGGCTGG - Intronic
1069075179 10:64031777-64031799 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1069692552 10:70363473-70363495 TTTCTCACAATTCTGGAGGCTGG - Intronic
1069762132 10:70818503-70818525 TATCTCACTATCCCAGAGGGTGG + Intronic
1070068584 10:73063183-73063205 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1070462139 10:76680938-76680960 TTTCTCACAATTCTGGAGGTTGG - Intergenic
1070557749 10:77542193-77542215 TTTCTCACAATTCTGGAGGATGG - Intronic
1070683735 10:78466805-78466827 TTCCTTACCACTCCAGAGAATGG + Intergenic
1070941792 10:80354824-80354846 TTTCTCACCATTCTGGAGGCTGG - Intronic
1071291531 10:84192887-84192909 TTTCTCTGCTTTGCAGAGGAGGG - Intergenic
1071406335 10:85336894-85336916 TTTCTCACATTTCAAGAGGCTGG + Intergenic
1071549161 10:86552929-86552951 TTTCTCACAGTTCTAGAGGGTGG - Intergenic
1071762182 10:88620837-88620859 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1071788205 10:88926614-88926636 TTTCTCACAGTTCCGGAGGCTGG - Intronic
1071852177 10:89585095-89585117 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1071918697 10:90325460-90325482 TTTCTCACAATTCTGGAGGCGGG + Intergenic
1071964857 10:90842325-90842347 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1072412407 10:95215757-95215779 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1072528362 10:96294963-96294985 TTTCTCTCCATTCTAGAGTCTGG - Intergenic
1072619570 10:97070759-97070781 TTTCTCACAGTTCTAGAGGTGGG - Intronic
1072856461 10:98952668-98952690 TTTCTCACAATTCTGGAGGCTGG + Intronic
1072897561 10:99379877-99379899 TTTCTCACCATTCTGGAGGTTGG + Intronic
1073517716 10:104092334-104092356 TTTCTCACAATTCTAGAGGTTGG - Intergenic
1073843117 10:107520964-107520986 TTTCTCACAGTTCTGGAGGATGG + Intergenic
1073982248 10:109168003-109168025 TTTCTCAAGATTCTGGAGGATGG + Intergenic
1074246999 10:111704364-111704386 TTTCTTACCATTCTAGAGAACGG + Intergenic
1074410748 10:113226401-113226423 TTGCTCGCCATTTCAAAGGAAGG + Intergenic
1074606251 10:114971014-114971036 TTTCTCACCATTCTGGAGGCTGG + Intronic
1074757702 10:116637877-116637899 TTTCTCACAGTTCTGGAGGATGG + Intronic
1074879996 10:117648553-117648575 TCTCCCAACTTTCCAGAGGATGG + Intergenic
1074972297 10:118549075-118549097 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1075343260 10:121663887-121663909 TTTCTCCCAGTTCCAGAGGCTGG + Intergenic
1075409566 10:122217329-122217351 TTTCTGCCCATTTCTGAGGAGGG - Intronic
1075445648 10:122510901-122510923 TTTCTTAGCACTCCAGAAGATGG + Intronic
1075617524 10:123902520-123902542 TTTCTCACAGTTCCGGAGGCTGG + Intronic
1075652903 10:124141284-124141306 TTTCTCACTGTTCCGGAGGCTGG + Intergenic
1075783469 10:125032417-125032439 TTGCTCACAAAACCAGAGGAAGG - Intronic
1075987426 10:126799822-126799844 TTTCTCCCAGTTCCAGAGGCTGG + Intergenic
1076087222 10:127644272-127644294 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1076382518 10:130035152-130035174 TTTCTCACCATCCAGGAGGCTGG + Intergenic
1076382628 10:130035858-130035880 TTTCTCTCCATTCTGGAGGCTGG + Intergenic
1077396847 11:2328458-2328480 TTGCTCACAGTTCCAGAGGCTGG + Intergenic
1077493498 11:2873324-2873346 TTTCTCACCGTTCTGGAGGCTGG + Intergenic
1078443215 11:11384756-11384778 TTTCTCTCAGTTCCAGAGGCTGG - Intronic
1078622711 11:12923669-12923691 TTTCTCACATTTCTAGAGGCTGG + Intronic
1078701690 11:13691072-13691094 TTTCTCACCATTCTGGAGGCTGG + Intronic
1078712141 11:13803720-13803742 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1078827693 11:14946253-14946275 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1078909966 11:15721937-15721959 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1078918977 11:15809200-15809222 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1078964771 11:16326015-16326037 TTTCTCACAATTCTGGAGGCTGG - Intronic
1079531086 11:21454652-21454674 TTTGTCACAATTCTAGAGGCTGG + Intronic
1079771095 11:24460860-24460882 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1079794953 11:24789659-24789681 TTTCTCACAGTTCCAGAAGCTGG + Intronic
1080074078 11:28127380-28127402 TTTCTCACAATTCTGGAGAAGGG + Intronic
1080104465 11:28497596-28497618 TTTCTCACAATTCTAGAGGCTGG + Intergenic
1080194020 11:29586705-29586727 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1080220075 11:29892476-29892498 TTTCTCACCCTTCTAGAGGCTGG - Intergenic
1080311772 11:30902378-30902400 TTTCTCACAATTCGGGAGGCTGG - Intronic
1080397273 11:31901840-31901862 TTTCTCACCATTCTGGAGGCTGG + Intronic
1080621731 11:33992492-33992514 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1080905331 11:36539327-36539349 TTTCTGACACTTCCAGAGGCTGG - Intronic
1080970888 11:37275553-37275575 TTTCTCTCCATTCTGGAGGTTGG - Intergenic
1081117975 11:39228862-39228884 TTGCTTACCATTCCAGAGACTGG + Intergenic
1081121655 11:39273909-39273931 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1081207972 11:40296596-40296618 TTTGTAACCCTTTCAGAGGATGG + Intronic
1081718081 11:45265511-45265533 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1082810279 11:57475406-57475428 GTTCTGAGGATTCCAGAGGATGG - Intronic
1083357616 11:62078623-62078645 TTTCTAAGCATTCCAGATAAGGG + Intergenic
1083405805 11:62456197-62456219 TTTGTCACCATTCTGGAGGCTGG - Intronic
1084744573 11:71160611-71160633 TTTCTCACCTTTCTGGAGGCTGG - Intronic
1085064551 11:73482075-73482097 TTTCTTACAATTCTAGAGGCTGG - Intronic
1085390162 11:76178178-76178200 TCTCTCAACATCCCAGAGAAGGG + Intergenic
1086125898 11:83348142-83348164 TTTCTCAAAATTCTAGAGGTAGG - Intergenic
1086215747 11:84378396-84378418 TTTCTCACAATTCTGGAGAATGG - Intronic
1086493221 11:87376533-87376555 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1086810621 11:91305743-91305765 TTCCTCAGCTTTGCAGAGGAGGG + Intergenic
1086904982 11:92408053-92408075 TTTCTCATCATTCTAGAGGCTGG + Intronic
1087004020 11:93451010-93451032 TTGCTCACAGTTCCAGAGGCTGG + Intergenic
1087097597 11:94334557-94334579 TTTTTCACAATTCTAGAGGCTGG - Intergenic
1087528305 11:99346904-99346926 TTTCTTACAGTTCCAGAGGCTGG - Intronic
1087656327 11:100927735-100927757 TTTGTAAGCATTCAAGAGGATGG - Intronic
1087761335 11:102107138-102107160 TTTCTCACAGTTCCGGAGGTTGG + Intergenic
1087822545 11:102728694-102728716 TTTCTCACAGTTCTGGAGGACGG - Intergenic
1087916923 11:103821914-103821936 TTTCTCACAAGTCAAGAGAATGG - Intergenic
1087929513 11:103960753-103960775 TTTCTGACAGTTCTAGAGGATGG + Intronic
1088009633 11:104984380-104984402 TTTCTCACAATTCTAGAGGCTGG - Intergenic
1088119483 11:106351328-106351350 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1088875143 11:113929344-113929366 TTTCTCACAATTCTGGAGGCTGG + Intronic
1088942358 11:114472603-114472625 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1089021909 11:115224633-115224655 ATTCACCCCAGTCCAGAGGAAGG + Intronic
1089143849 11:116309980-116310002 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
1089188096 11:116634727-116634749 TTTCCCACAGTTCCAGAGGCTGG + Intergenic
1089739413 11:120572021-120572043 TTTCTCACCATTCTGGAGGCAGG + Intronic
1089766627 11:120772288-120772310 TTTCTCAGAATTCCAGAGGCGGG + Intronic
1089769785 11:120794688-120794710 TTTCTCACAATTCTGGAGGCTGG - Intronic
1089799770 11:121016163-121016185 TATCTAACCATTCCATAGGGAGG + Intergenic
1090033621 11:123229187-123229209 TTTCTTACAGTTCCAGAGGCTGG - Intergenic
1090052752 11:123394754-123394776 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1090500819 11:127258843-127258865 TTTCTCTCCTTTCCTGAAGAGGG + Intergenic
1090705345 11:129331226-129331248 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1090909397 11:131105330-131105352 TTTCTCACACTTCTAGAGGCTGG + Intergenic
1090963011 11:131573767-131573789 TTTCTCACTCTTCAAGAGAAAGG - Intronic
1091141887 11:133242428-133242450 TTTCTCACACTTCCAGAGGTAGG + Intronic
1091155144 11:133365310-133365332 TTTCTCACAATTCTGGAGGCTGG + Intronic
1091197372 11:133743360-133743382 TTTCTCACCATTCTGGAGGCTGG - Intergenic
1091526680 12:1309092-1309114 CTTCTCACAGTTCCAGAGGCTGG - Intronic
1091619941 12:2079376-2079398 TTTCTCACAATTCTGGAGGCTGG + Intronic
1091699643 12:2651254-2651276 TTCCTCAGCAGTGCAGAGGAGGG + Intronic
1092310889 12:7351343-7351365 TTTCTCACAGTTCTAGAGGTTGG + Intronic
1092522506 12:9289214-9289236 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1092544777 12:9442683-9442705 TTTCTCACCATTCTGGAGGCTGG - Intergenic
1092604031 12:10099761-10099783 TTTCTCAGCATTCCAGAAGGTGG + Intronic
1092697537 12:11190463-11190485 TTTCTCACAGTTTGAGAGGATGG + Intergenic
1092849138 12:12611533-12611555 TTCCTCAGCGTCCCAGAGGAGGG + Intergenic
1092908292 12:13122410-13122432 TTTCTCACAGTTCTGGAGGATGG + Intronic
1093021566 12:14208751-14208773 TTTCTCACAGTTCCGGAGGTGGG + Intergenic
1093083373 12:14839436-14839458 TTTCTCACAATTCTGGAGGATGG + Intronic
1093167213 12:15817865-15817887 TTTCTCACAATTCTGGAGGCTGG + Intronic
1093262627 12:16957805-16957827 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
1093606088 12:21089658-21089680 TTTTTCTCCATCCCAGAGGAAGG + Intronic
1093772667 12:23035703-23035725 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1093795733 12:23308101-23308123 TTTCACACAGTTCCAGAGGTTGG - Intergenic
1093806204 12:23435940-23435962 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1093997137 12:25654770-25654792 TTCCTCACAGTTCCAGAGGCTGG + Intergenic
1094005298 12:25742784-25742806 TTTCTCACCATTGAAGGGGCTGG + Intergenic
1094158515 12:27363977-27363999 TTTCTGACAATTCTAGAGGCTGG + Intronic
1094195378 12:27743759-27743781 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1094214746 12:27928975-27928997 TTTCTCACCATTCTGGAAGCTGG + Intergenic
1094304111 12:28998553-28998575 TTTCACCCCAATGCAGAGGAAGG - Intergenic
1094305578 12:29015927-29015949 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1094438229 12:30445378-30445400 TTTCTCCCAATTCTAGAGGCTGG - Intergenic
1094444643 12:30516399-30516421 CTTCTCACAGTTCCAGAGGCTGG + Intergenic
1094508171 12:31079389-31079411 TTTCTCACCATTCTGGAGGCTGG + Intronic
1094741363 12:33293022-33293044 TTTCTCACAGTTTCAGAGGCTGG + Intergenic
1095159429 12:38899436-38899458 TTTCTCACAGTTGTAGAGGATGG - Intronic
1095251623 12:39985945-39985967 TTTCTCACCATTCTGGAGGCTGG + Intronic
1095371102 12:41468346-41468368 TTTCTCACCCATACATAGGAGGG + Intronic
1095527346 12:43142956-43142978 TTTCTCGCAGTTCTAGAGGATGG - Intergenic
1095933783 12:47655145-47655167 TTTCTCACCATTCTAGAGAATGG + Intergenic
1096569190 12:52510459-52510481 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1097027419 12:56067569-56067591 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1097324394 12:58259503-58259525 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1097440442 12:59601679-59601701 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1097641107 12:62183316-62183338 TTTCTCACAATTCTGGAGGCTGG - Intronic
1097663210 12:62453133-62453155 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1098164065 12:67674861-67674883 TTTCTCACAATTCCGGAGGCTGG - Intergenic
1099389534 12:82062312-82062334 TTCCTCACAGTTCTAGAGGACGG - Intergenic
1099392608 12:82099004-82099026 TTTCTCACAGTTCCAAAGGCTGG - Intergenic
1099504790 12:83460473-83460495 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1099748205 12:86734730-86734752 TTTCTCACAATTCCAGTGGCTGG - Intronic
1099809969 12:87568511-87568533 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1100222560 12:92521665-92521687 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1100374239 12:93997804-93997826 TTTCTCACCATTCTGGAGGCTGG - Intergenic
1100450298 12:94699512-94699534 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1100685623 12:96983695-96983717 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1100726760 12:97417243-97417265 TCTCTCGCAATTCCAGAGGCTGG + Intergenic
1100747279 12:97660362-97660384 TTTCTCACAGTTCCAGATGCTGG + Intergenic
1100841178 12:98612948-98612970 TTTCTCACTGTTCTAGAGGCTGG - Intergenic
1101161040 12:101976714-101976736 TTTCTCACCATTCTGGAGGCTGG - Intronic
1101469280 12:104981483-104981505 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1101600443 12:106205096-106205118 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1101702322 12:107185861-107185883 TTTCTCACCATTTTGGAGGTTGG - Intergenic
1101750080 12:107576350-107576372 TTTCTCCCCATTCTGGAGGCTGG + Intronic
1102499875 12:113344619-113344641 TTTCTCATCATTCTGGAGGCTGG - Intronic
1102540051 12:113612133-113612155 TCCCTCTCCATGCCAGAGGATGG + Intergenic
1102596775 12:113998911-113998933 TTTCTCACTGTTCCAGAGGCCGG - Intergenic
1102703465 12:114860832-114860854 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1102799417 12:115718483-115718505 TTTCTCACCGTTCCAGAGGCTGG + Intergenic
1102817701 12:115881059-115881081 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1102934565 12:116885496-116885518 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1103038749 12:117677498-117677520 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1103243025 12:119430786-119430808 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1103843452 12:123884430-123884452 TTTCTCACCATTCTGGAGGCTGG + Intronic
1104070327 12:125339247-125339269 TTTCTCACAATTCTGGAGGCTGG + Intronic
1104086161 12:125475821-125475843 CTTCTCACCATCCCAAAGAAAGG - Intronic
1104168368 12:126255886-126255908 TATCTCACCCTTCAAAAGGAGGG - Intergenic
1104430671 12:128713496-128713518 TTTCTCACCATTCTGGAGGACGG + Intergenic
1104447074 12:128843312-128843334 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1104510577 12:129374155-129374177 TTTCTCAGCATTCTGGAAGATGG + Intronic
1104809733 12:131612890-131612912 TTTTTCACCATTCTAGAGGCTGG + Intergenic
1104918319 12:132277892-132277914 TTTCTCACCATTCTCGAGGCCGG - Intronic
1105529963 13:21210325-21210347 TTTCTTACTATTCTAGAGGGTGG - Intergenic
1106484211 13:30158362-30158384 TTTCCCACAGTTCCAGAGGCTGG + Intergenic
1106488318 13:30192218-30192240 TTCCTCACCATTTCACAGGTGGG + Intergenic
1106797893 13:33226146-33226168 TTTCTCACAGTTCTGGAGGATGG - Intronic
1106871958 13:34031227-34031249 ATTCTCACAGTTCCAGAGGCTGG - Intergenic
1106875041 13:34062652-34062674 TTTCTCAACTCTCCAGAGGATGG - Intergenic
1106930657 13:34660601-34660623 TTTCTCACAATTCTGGAGGTTGG + Intergenic
1107019269 13:35735015-35735037 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1107076432 13:36325941-36325963 TTTCTCACAATTCTAGAGGCTGG + Intronic
1107121159 13:36797633-36797655 TTTCTCACCATTCTAGAGAGTGG + Intergenic
1107299593 13:38950948-38950970 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1107428694 13:40319165-40319187 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1107670198 13:42737851-42737873 TTTCTCACCATTCCAGAGTCTGG + Intergenic
1107748840 13:43542810-43542832 TTTCTCACAGTTCCAGAGGCTGG + Intronic
1107809434 13:44186113-44186135 TTTCTCACAATTCAGGAGGCTGG + Intergenic
1107869638 13:44734986-44735008 TGTCTCACCTTCCCAGAAGATGG + Intergenic
1107930335 13:45301827-45301849 TTTCTCCCAGTTCCAGAGGCTGG + Intergenic
1108129843 13:47286927-47286949 TTTCTCACCATTACAAACTAAGG - Intergenic
1108161478 13:47644792-47644814 TATCTCACAATTCTAGAGGTTGG - Intergenic
1108223526 13:48263647-48263669 TTTCTCACAGTTCCAGAAGCTGG + Exonic
1108805653 13:54152621-54152643 TTTCTCACAGTTTCAGAGGCTGG + Intergenic
1108920375 13:55665808-55665830 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1109179781 13:59199875-59199897 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1109524797 13:63561804-63561826 TTTCTTACACTTCCTGAGGAAGG + Intergenic
1109641326 13:65195251-65195273 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1109682801 13:65774653-65774675 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1110015335 13:70393096-70393118 TTTCTCACCATTTTGGAGGCTGG - Intergenic
1110177406 13:72573590-72573612 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1110186424 13:72680685-72680707 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1110379715 13:74836331-74836353 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1110395610 13:75026981-75027003 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1110503357 13:76254872-76254894 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1110509120 13:76328225-76328247 TTTCTTACAATTCTAGAGGCTGG + Intergenic
1110551013 13:76811551-76811573 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1110744037 13:79031715-79031737 TTTCTCACACTTCCAGTGGCTGG - Intergenic
1110801619 13:79703582-79703604 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1110931405 13:81223090-81223112 TTTCTCACAGTTCTAGAGGTTGG - Intergenic
1111002480 13:82204185-82204207 TTTCTCACCGTTCTGGAGGCAGG - Intergenic
1111258952 13:85710100-85710122 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1111260573 13:85734479-85734501 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1111716000 13:91879449-91879471 TATCTCACAATTCCAGGGGCTGG + Intronic
1111737117 13:92156239-92156261 TTTCTTACCATTCAGGATGAGGG - Intronic
1111827096 13:93281268-93281290 TTTCTCACAATTCTGGAGGCTGG + Intronic
1112034416 13:95484080-95484102 TTTCTCACAATTCTAGAGGCTGG - Intronic
1112269548 13:97955813-97955835 TTTTTCACCTTTCCAGAGTGGGG - Intronic
1112344874 13:98580839-98580861 TTCCTCACCATTCTGGAGGCTGG + Intergenic
1112358735 13:98697022-98697044 TTTCTCACAGCTCCAGAGGCTGG - Intronic
1112574907 13:100627091-100627113 TTTCTCACAGTGCCAGAGGCTGG - Intronic
1112934706 13:104783124-104783146 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1113074509 13:106454687-106454709 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1113173455 13:107533521-107533543 TTTCTTACCATTCAAAAGGCAGG - Intronic
1113250025 13:108442460-108442482 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1113289642 13:108890503-108890525 TTTCTCACCTGCTCAGAGGAAGG + Intronic
1113314000 13:109159578-109159600 TTTGCCCACATTCCAGAGGAAGG + Intronic
1113334180 13:109362597-109362619 TCTCTCACAGTTCCAGAGGCTGG + Intergenic
1113359105 13:109611999-109612021 TGTCTCACAATTCTAGAGGCTGG + Intergenic
1113363209 13:109651048-109651070 TTTTTAACCATCCTAGAGGAAGG + Intergenic
1113416028 13:110129392-110129414 TGTCTCACCATTCTGGAGGCTGG - Intergenic
1113449926 13:110401777-110401799 TTTCTCACTGTTCTAGAGGCTGG + Intronic
1113474249 13:110568894-110568916 TTTCTCACCGTTCTGGAGGCTGG - Intergenic
1113684626 13:112274256-112274278 TTTCTCCCCATTGTACAGGAGGG - Intergenic
1113971352 13:114193401-114193423 TTTCTCACAGTTCCAGAGACTGG + Intergenic
1114187606 14:20414635-20414657 TTTCTCACAGTTCTAGAGAATGG - Intergenic
1114214836 14:20649201-20649223 TTTCTCACCATTCTAGAGGCTGG + Intergenic
1114570420 14:23663408-23663430 TTTCTCACACTTCTAGAGGCTGG - Intergenic
1114744114 14:25128282-25128304 TTTCTCACTGTTCTAGAGGCGGG - Intergenic
1114777762 14:25504620-25504642 TTTCTCACCATTGCAGAACAAGG - Intergenic
1115121164 14:29940070-29940092 TTTCTCACAATTCTGGAGGCTGG - Intronic
1115342739 14:32309566-32309588 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1115661625 14:35500462-35500484 TTTCTCCCCATTCAATATGATGG - Intergenic
1116020248 14:39452029-39452051 TTTCTCACTATTGGAGAAGAAGG + Intergenic
1116034336 14:39610036-39610058 TTTCTCACTGTTCTAGAGGCTGG - Intergenic
1116095891 14:40367040-40367062 TTTCTCACAGTTCTAGAGGTTGG + Intergenic
1116175419 14:41464100-41464122 TTTCTGACCATTCTGGAGGCTGG + Intergenic
1116282004 14:42920376-42920398 TTTCTCACAGTTCTAGAGGATGG + Intergenic
1116330257 14:43587128-43587150 GTTCTTATCATTTCAGAGGAAGG + Intergenic
1116526670 14:45915112-45915134 TTTCTTACCATTCTAGAGCCTGG - Intergenic
1116665352 14:47767368-47767390 TTTCTCACAGTTCTGGAGGATGG + Intergenic
1116670288 14:47832201-47832223 TTTCTCACAGTTCCGGAGGCTGG - Intergenic
1116688842 14:48079039-48079061 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1116690255 14:48097169-48097191 TTTCTCACCATTCCTCATGTGGG - Intergenic
1116721217 14:48498231-48498253 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1116806643 14:49500475-49500497 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1117011155 14:51472065-51472087 TTTCTAACCGTTCTAGAGGCTGG - Intergenic
1117122385 14:52582078-52582100 TTTCTCACCATTCTGGAGGCTGG + Intronic
1117249167 14:53918281-53918303 TTTCTCACAGTTTCAGAGGCTGG + Intergenic
1117437937 14:55735231-55735253 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1117444478 14:55790394-55790416 TTTCTCACAATGCTAGAGGCTGG - Intergenic
1117873521 14:60225411-60225433 TATCTTACAGTTCCAGAGGACGG + Intergenic
1118467465 14:66043894-66043916 CTTCTCATCATTCTAGAGGCTGG - Intergenic
1118493547 14:66285741-66285763 TTTCTCACAATTCTAGAGGCTGG + Intergenic
1118783397 14:69025515-69025537 TTTCTCACCATTCTAGGGACTGG + Intergenic
1118878465 14:69805123-69805145 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
1118995911 14:70835762-70835784 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1119537277 14:75412730-75412752 TTTCTCATCATTCTGGAGGCTGG - Intergenic
1119547631 14:75483949-75483971 TTTCTCACATTTCTGGAGGATGG + Intergenic
1119724184 14:76912104-76912126 TTTCTCACAGTTCCAAAGGATGG - Intergenic
1120192572 14:81452531-81452553 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1120481075 14:85050088-85050110 TTTCTCTACATTTCAGAGGAAGG - Intergenic
1120504664 14:85340032-85340054 TTTCTCACAATTCAAGAGGCTGG - Intergenic
1120677004 14:87432153-87432175 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1120763873 14:88310635-88310657 GTTCTCACCCTGCCAGAGAAAGG + Intronic
1120932398 14:89861858-89861880 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1121421595 14:93819353-93819375 TGTCTGACCATTCCAGAGCAAGG - Intergenic
1121555159 14:94830937-94830959 CTTCTCACCATTCTGGAGGCTGG + Intergenic
1121567668 14:94922952-94922974 TCTCTCACCATTCTGGAGGCTGG + Intergenic
1121677250 14:95763876-95763898 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1121841001 14:97133730-97133752 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1121879444 14:97486963-97486985 TTTCTCACCGTTCTGGAGGCTGG + Intergenic
1121960862 14:98258218-98258240 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1121977621 14:98420201-98420223 TTTCTCACCATTCAGTGGGAAGG - Intergenic
1122401988 14:101472838-101472860 TTTCCCACCATTCAGGAGGCTGG + Intergenic
1122458688 14:101877988-101878010 CTTCTCTCCATTCTAGAGGCTGG + Intronic
1122927360 14:104911488-104911510 TGTCTCACAGTTCCAGAGGCTGG - Intergenic
1123726281 15:23105603-23105625 TTGCTCACCATTCTGGAGGCTGG + Intergenic
1124143571 15:27099321-27099343 TTTCTCACCATTCTGGAGGCTGG + Intronic
1124177051 15:27436136-27436158 TTTCTCACAATTCTGGAGGCTGG + Intronic
1124233239 15:27964929-27964951 TTCCTCACCGTTCCTGAGTAAGG - Intronic
1124377199 15:29135844-29135866 TTTCTCCCCACCCCAGAGGGCGG + Intronic
1124585024 15:30997099-30997121 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1124866111 15:33492977-33492999 TATATCATCATTCCAGAGGGAGG + Intronic
1125007386 15:34833092-34833114 TTTCTCACAATTCTGGAGGTTGG + Intergenic
1125009900 15:34860144-34860166 TCTCTCTCCATTCTAGAAGAAGG + Exonic
1125119395 15:36136009-36136031 TTTCTCACTATTCTAGAGACTGG + Intergenic
1125352492 15:38782459-38782481 TCTCTCACAATTCTAGAGGCTGG + Intergenic
1125449720 15:39795766-39795788 ATTCTCACCATGCCACATGATGG + Intergenic
1125460340 15:39900685-39900707 TGACCCACCATTCCAGAAGAAGG + Intronic
1125844594 15:42839936-42839958 TTTCTTACCATTCTGGAGGTTGG - Intronic
1126343331 15:47667586-47667608 TTTCTCACAGTTGCAGAGGCTGG + Intronic
1126796356 15:52263104-52263126 TTCCTCACCGTTCTAGAGGCTGG - Intronic
1126964015 15:54030669-54030691 TTTCTCACAGTTCCAGAGGTTGG + Intronic
1127057015 15:55142463-55142485 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1127080821 15:55377836-55377858 TTTCTCACAATTATAGAGGCTGG - Intronic
1127375952 15:58384447-58384469 TTTCTCATAGTTCCAGAGGCTGG + Intronic
1128649792 15:69402157-69402179 TTTCTCACAATTCTGGAGGCTGG + Intronic
1128846437 15:70901180-70901202 TTCCTCACCATACCTCAGGAAGG - Intronic
1129056243 15:72822452-72822474 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1129257426 15:74341957-74341979 TTTCTCACAGTTCCGGAGGCTGG - Intronic
1129293241 15:74584587-74584609 TTCCTCCCCATTGCAGAGAATGG - Intronic
1129915925 15:79271602-79271624 TTTATAACCATTCAGGAGGATGG + Intergenic
1129923076 15:79337156-79337178 TTTCTCACCGTTCTGGAGGCAGG + Intronic
1130162871 15:81419086-81419108 TTTCTCACAGTTCTAGAGGGCGG - Intergenic
1130204483 15:81863626-81863648 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1130510187 15:84582766-84582788 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1130554570 15:84913800-84913822 TTTCTCACACTTCTAGAGGCTGG + Intronic
1130702494 15:86198812-86198834 TTTCCCACCAGTCTAGAGGCTGG - Intronic
1130904052 15:88227622-88227644 TTCCTCACCGTTCTAGAGGCTGG - Intronic
1131329302 15:91481800-91481822 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1131468736 15:92676633-92676655 TTTCTCACAGTTTCAGAGGCTGG - Intronic
1131550897 15:93355982-93356004 TTTCTCACGATTCTCGAGGCTGG + Intergenic
1131610641 15:93957902-93957924 TTTCTCACAGTTCTAGAGGTGGG + Intergenic
1133062778 16:3185586-3185608 TTTCTCACTATTCTGGAGGCTGG - Intergenic
1133451256 16:5905785-5905807 TTTCTCACCCTTCAGGAGGATGG - Intergenic
1133451629 16:5908995-5909017 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1133667991 16:7988601-7988623 TTTATGATCATTTCAGAGGAAGG - Intergenic
1133907829 16:10038090-10038112 TTTCTCTCAGTTCCAGAGGTTGG + Intronic
1134297189 16:12957372-12957394 TTTCTCACGATTCCGGAGGCTGG + Intronic
1134297865 16:12962680-12962702 TTTCTCACAATTCTGGAGGCTGG - Intronic
1134506472 16:14811664-14811686 TTTCTCACAATTCTGGAGGCTGG + Intronic
1134574082 16:15317101-15317123 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1134728338 16:16439200-16439222 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1134939102 16:18272632-18272654 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1135050816 16:19191496-19191518 TTTCTCACCCTTCTGGAGGCTGG - Intronic
1135654745 16:24238134-24238156 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1135829399 16:25760220-25760242 TTTCTCACAGTTCCAGAGGATGG + Intronic
1135835136 16:25818421-25818443 TTTCTCATGGTTCCAGAGGCTGG - Intronic
1135835545 16:25822192-25822214 TTTCTCACCGTTCTGGAGGCTGG + Intronic
1136058404 16:27707689-27707711 TTTCTCACAATTCCGAAGGCTGG + Intronic
1136112204 16:28070766-28070788 TTTTACTCCATTCCTGAGGAGGG + Intergenic
1136492980 16:30622747-30622769 TTGGCCACAATTCCAGAGGAAGG - Intronic
1136496911 16:30650650-30650672 TTTCTCACCACCCCGGAAGACGG + Intergenic
1136558113 16:31020760-31020782 TTTCTCACAGTTCCAAAGGCTGG - Intergenic
1137376077 16:47952989-47953011 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1137466371 16:48713539-48713561 TTTCTCATAGTTCCAGAGGTTGG - Intergenic
1137538632 16:49346729-49346751 TTTCTCAGCTTTGGAGAGGAGGG - Intergenic
1138141709 16:54574195-54574217 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1138233039 16:55353751-55353773 TTTCTCACAGTTCTTGAGGATGG - Intergenic
1138398794 16:56729417-56729439 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1138647819 16:58438067-58438089 TTTCTCACAATTATGGAGGATGG - Intergenic
1140141095 16:72258684-72258706 TTTCTCACAATTCTAGAGGCTGG + Intergenic
1140337534 16:74122326-74122348 TTTCTCTCCACTACACAGGATGG - Intergenic
1140521802 16:75588231-75588253 TTTCTTACCATTCTGGAGGCTGG + Intergenic
1140574208 16:76145858-76145880 TTTCTCACTGTTCTAGAGGCTGG - Intergenic
1140905570 16:79406388-79406410 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1141062569 16:80887669-80887691 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1141629102 16:85277148-85277170 TTTCTCCCCACTCCACAGGCTGG - Intergenic
1141661244 16:85442812-85442834 TCTCTCACGGTTCCAGAGGCCGG + Intergenic
1142887530 17:2922091-2922113 TTTCTCACCATTCTGGAGGCTGG + Intronic
1143993024 17:10982811-10982833 TGTCTCATCATTCTAGAGGCTGG + Intergenic
1144060718 17:11581629-11581651 TTTCTCACCGTTCTAGAGACTGG + Intergenic
1144165372 17:12605048-12605070 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1144174839 17:12695180-12695202 TTTCTCACCGTTCCAGAGGCTGG + Intronic
1144271224 17:13618087-13618109 TTTCTCACAGTTTCAGAGGCTGG - Intergenic
1144282894 17:13744655-13744677 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1144382696 17:14718511-14718533 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1144751151 17:17648906-17648928 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1144752589 17:17659724-17659746 TTTCTCACAGTTCCGGAGGCTGG - Intergenic
1144838745 17:18172611-18172633 TTTCTCACAATTCTGGAGGCTGG + Intronic
1145267862 17:21389133-21389155 TGTTTCAGAATTCCAGAGGACGG + Intronic
1145750447 17:27351507-27351529 TTTCTTACAATTCTAGAGGCTGG - Intergenic
1145834460 17:27943785-27943807 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1146092480 17:29893588-29893610 TTTCTCACAGTTCTGGAGGATGG - Intronic
1146551640 17:33785295-33785317 TTCCTCACAGTTCCAGAGGCTGG - Intronic
1146592256 17:34137686-34137708 TTTCTCACAGTTCCAGAGGCTGG + Intronic
1146625354 17:34431096-34431118 TGTCTCACAGTTCCAGAGGCTGG - Intergenic
1146645610 17:34575392-34575414 TTTCTCACCGTTCTGGAGGCTGG - Exonic
1146672584 17:34751883-34751905 TTTCTCACAGTTCCAGTGGCTGG + Intergenic
1146734851 17:35229909-35229931 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1146840132 17:36146275-36146297 TTTCTCACCATTCTGGAGAATGG + Intergenic
1147117426 17:38311825-38311847 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1147263591 17:39222646-39222668 CTTCTCCCCATGCCAGAGAATGG - Intronic
1147900688 17:43781679-43781701 TTTCCCACGATCTCAGAGGAGGG + Intronic
1148405475 17:47410139-47410161 TTTCTTACAATTCTAGAGGCTGG + Intronic
1148412260 17:47477763-47477785 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1148998684 17:51734837-51734859 TTTTTCACCGTTCTGGAGGATGG + Intronic
1149239204 17:54629320-54629342 TTTCTTACCATTCCAGGTGCTGG + Intergenic
1149307685 17:55364912-55364934 TTTCTCATAATTCTAGAGGCTGG + Intergenic
1149382984 17:56112276-56112298 TTCCTCACCATTCTGGAGGGAGG - Intronic
1149400983 17:56295710-56295732 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1149881830 17:60299796-60299818 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1150132794 17:62678413-62678435 TTTCCCACCATGGCAGAGGAGGG - Intronic
1150714730 17:67562186-67562208 TTACTCAGCATGTCAGAGGACGG + Intronic
1150726452 17:67655108-67655130 TTTTTTACAATTCCAGAGGCTGG + Intronic
1151047584 17:70939716-70939738 TCTCTCTCCATACCAGAGGTTGG + Intergenic
1151161638 17:72170961-72170983 AGTCTCACCAATTCAGAGGATGG - Intergenic
1151244374 17:72783238-72783260 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1151406789 17:73892828-73892850 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1151910975 17:77083093-77083115 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1152102404 17:78309824-78309846 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1152475063 17:80512543-80512565 TTTCTCACCATTTGAGGGGCCGG + Intergenic
1152536509 17:80953214-80953236 ATTCTCACCACTCCAGAAGGCGG + Intronic
1152785728 17:82247016-82247038 TTTGTCACCATCTCACAGGAAGG - Intronic
1153048843 18:882264-882286 TTTCTCACAATTACAGTGAAAGG - Intergenic
1153166825 18:2271059-2271081 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1153433763 18:5047356-5047378 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1153678038 18:7473031-7473053 TTTCTCACAATTCTAGAGGCTGG - Intergenic
1153885529 18:9461330-9461352 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1154055556 18:11009946-11009968 TATCTCACCATTCTGGAGGCTGG - Intronic
1154126235 18:11694784-11694806 TTTCTCACAATTCTGGAGGTTGG + Intronic
1154398919 18:14016595-14016617 TTCCTCACCACTCTTGAGGATGG + Intergenic
1155003512 18:21707883-21707905 TTTCTCACTGTTCTAGAGGCTGG + Intronic
1155312228 18:24535047-24535069 TTTCTCACCGTTTTAGAGGCTGG - Intergenic
1155513042 18:26596407-26596429 TTTCTTACAGTTCTAGAGGATGG - Intronic
1155553136 18:26987910-26987932 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1155620155 18:27768988-27769010 CTCCTCACCATGACAGAGGAAGG + Intergenic
1155760153 18:29555005-29555027 TTTCTCACAGTTCTGGAGGAGGG - Intergenic
1155939008 18:31784879-31784901 TATCTCACCATTCTGGAGGCTGG - Intergenic
1156173458 18:34514640-34514662 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1156260317 18:35440076-35440098 CTTCTCACCCTCACAGAGGAAGG + Intergenic
1156309796 18:35911406-35911428 TTTCTCACCATTCTGGAGGCTGG - Intergenic
1156632220 18:38983921-38983943 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1156644151 18:39139713-39139735 TTTCTCACCATTCTGAAGGCTGG - Intergenic
1157216702 18:45789702-45789724 TTTCTCACCATTCTGGAGGCTGG - Intergenic
1157301769 18:46484535-46484557 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1157416350 18:47506538-47506560 TTTCTCACCGTTCTAGAAGCTGG - Intergenic
1157819516 18:50755235-50755257 TTTCTCTCCATTTCAGAGATTGG + Intergenic
1157862189 18:51151520-51151542 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1157887141 18:51379682-51379704 TTTCTCACGGTTCTAGAGGTTGG - Intergenic
1158618585 18:59010520-59010542 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1158683302 18:59588997-59589019 TTTCCCAGCATCCCAGAGGGAGG + Intronic
1158727573 18:59987474-59987496 TTTCTCACAGTTCTAGAGGTTGG - Intergenic
1158943627 18:62429120-62429142 GTTCTCACCATTCTAGAGGCTGG - Intergenic
1159120104 18:64159080-64159102 TTCCTCACATTTCCAGATGATGG + Intergenic
1159378336 18:67623780-67623802 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1159473824 18:68891593-68891615 TTTCTCACAGTTCTGGAGGATGG + Intronic
1159477701 18:68944396-68944418 TTTCTCACGTTTCCAGAGGCTGG + Intronic
1160015624 18:75138228-75138250 TTTCTCACCATTCTGGAGGCAGG + Intergenic
1160020563 18:75177400-75177422 TTTCTCACCATTCTGGAGGCTGG - Intergenic
1160183329 18:76655022-76655044 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1160247837 18:77173857-77173879 TGGCTCAGCATTACAGAGGAGGG + Intergenic
1160487906 18:79310176-79310198 ATTCTCACCCTTCCACAGCAAGG - Intronic
1161493605 19:4575839-4575861 CTTCTGACCATTCCATAGGTGGG + Intergenic
1161538972 19:4838095-4838117 TTTCTCACAGTTCCGGAGGCGGG - Intergenic
1161641388 19:5425625-5425647 TTTCTCAGCATTGTAGAGCAGGG - Intergenic
1162311435 19:9909761-9909783 GTTCTCCCCAGTCCTGAGGAAGG + Intronic
1163042382 19:14612184-14612206 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1164409056 19:27982288-27982310 TTTCTCCCCATCCCAGAGTCAGG + Intergenic
1164516110 19:28936991-28937013 TTTCTCACCATTTGGGAGGCAGG - Intergenic
1164603337 19:29578258-29578280 TTTCTCACCATTCTAGAGGCTGG - Intergenic
1164657510 19:29934385-29934407 TTTCTCACAATTCTGGAGGCTGG + Intronic
1164672572 19:30081187-30081209 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1164916283 19:32054781-32054803 TTTCTCACCATTCTGGAGGTTGG + Intergenic
1164961474 19:32434728-32434750 TTTCTCACAATTCAGGAGGCTGG + Intronic
1165174422 19:33917004-33917026 CTTCTCACAGTTCCAGAGGCTGG - Intergenic
1165526079 19:36355822-36355844 TTTCTCACAATTCTAGATGCTGG - Intronic
1165563814 19:36706030-36706052 TTTCTCACAATTCTGGAGGCTGG + Intronic
1166338458 19:42122746-42122768 TGTCTCATCTTGCCAGAGGAGGG - Intronic
1167677628 19:50897316-50897338 TTTCTCACCATTCTGGAGACCGG - Intergenic
1167695057 19:51010280-51010302 TTTCTCAACATTCTAGGAGAGGG - Intergenic
1167789870 19:51668248-51668270 TTTCTCACTATTCTGGAGGCTGG + Intergenic
1168399739 19:56078394-56078416 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1168510889 19:56972866-56972888 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1168654487 19:58117677-58117699 TTTCTCACCTTCCCAGGGTATGG - Intronic
925067444 2:939418-939440 TCTCTCTCCATTCCAGGGCAAGG + Intergenic
925305215 2:2843518-2843540 TTTCTCACAATTCTGGAGGCTGG - Intergenic
925674397 2:6345016-6345038 TTTCTCACACTTCCAGAGGCTGG - Intergenic
925700314 2:6630193-6630215 TTTCTCAGCTTTCTAGAGTAGGG - Intergenic
926087736 2:10030533-10030555 TTTCTCACAGTTCCGGAGGCTGG - Intergenic
926097231 2:10089561-10089583 TTTCTCACAGTTCCGGAGGCTGG - Intergenic
926165514 2:10520543-10520565 TTTCTCACCATTCTGGAGGCTGG + Intergenic
926351080 2:11994989-11995011 GTTGTCACCATTCTAGAGGCTGG - Intergenic
926375059 2:12219077-12219099 TTTCCCACCAGTCAAGAGGCTGG - Intergenic
926379221 2:12267862-12267884 TTTCTCCCAATTCCAGAGGCTGG + Intergenic
926975305 2:18510563-18510585 TTTCTCACAGTTCTAGAGGGTGG - Intergenic
926977989 2:18534066-18534088 TTTCTCATGGTTCCAGAGGCTGG + Intergenic
926984771 2:18610854-18610876 TCTCTCACAATTCTAGAGGCTGG - Intergenic
926996316 2:18739792-18739814 TTTCTCACAGTTCTAGAGGATGG - Intergenic
927035402 2:19170154-19170176 TTTCTCACAGTTCCAGAAGCTGG + Intergenic
927186316 2:20485056-20485078 TTTCTCACCTCTCCAGAGGCTGG - Intergenic
927382513 2:22495458-22495480 TTTCTCACAATTCTGGAGGCTGG - Intergenic
927466124 2:23337943-23337965 TTTCTCATCGTTCTAGAGGCTGG - Intergenic
928302999 2:30143465-30143487 TTTCTCACAATTCTGGAGGCTGG + Intergenic
928415468 2:31088046-31088068 TTTCTCACAGTTCTAGAGGCTGG - Intronic
928868276 2:35944873-35944895 TATCTCACCATTCTGGAGGTTGG - Intergenic
928892089 2:36216061-36216083 TTTCTCATGCTTCTAGAGGATGG - Intergenic
929050730 2:37834593-37834615 TTTCTCACAGTTTCAGAGGCTGG + Intergenic
929278647 2:40053582-40053604 TTTCTCACAATTCTGGAGGCTGG - Intergenic
929627223 2:43421658-43421680 TTTTTCTCCATTCCAGATGTTGG - Intronic
929671661 2:43880770-43880792 TTTCTCACAATTAGAGAAGAGGG - Intergenic
929754469 2:44752646-44752668 ATTCTCACAGTTCCAGAGGCTGG + Intronic
930238537 2:48911433-48911455 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
930298413 2:49584312-49584334 TTTCTCACAATTACAGAGGCTGG + Intergenic
930315474 2:49792132-49792154 TTTCTCACCATTCTGGAGGCTGG + Intergenic
930485162 2:52002271-52002293 TTTCTCACAATTCTAAAGGATGG + Intergenic
930531638 2:52595870-52595892 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
930581773 2:53220132-53220154 TTTATCACCATTCTGGAGGCTGG - Intergenic
930603468 2:53468680-53468702 TTTCTCACCATTATGGAGGCTGG + Intergenic
931156145 2:59632730-59632752 TTTTTTATCATTCTAGAGGACGG - Intergenic
931438951 2:62273694-62273716 CTTCTCTCCTTCCCAGAGGATGG - Intergenic
931536839 2:63286967-63286989 TTTCTCACAGTTCCAGAAGCTGG + Intronic
931634891 2:64332207-64332229 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
931703972 2:64931787-64931809 TTTCTCACTGTTCTAGAGGCCGG + Intergenic
931785937 2:65619538-65619560 TTTCTCGCCACTCCAGATGTTGG + Intergenic
931853382 2:66276217-66276239 TTTCTGAAAATTCCAGAGGAGGG - Intergenic
932631999 2:73352776-73352798 TTTCTCACCATTCTAGAGTCTGG - Intergenic
932819823 2:74890069-74890091 TTTTTCAACATTCTAGAGCAGGG + Intronic
933202896 2:79471325-79471347 TTTCTCACAGTTCTAGAGGCTGG + Intronic
933238154 2:79888152-79888174 TTTATCACCATCCCAGAGGTAGG - Intronic
933269374 2:80216685-80216707 TTTCTCACCGTTCTGGAGGCTGG - Intronic
933290839 2:80436630-80436652 TTGCTCACAGTTCCAGAGGCTGG + Intronic
933493299 2:83016456-83016478 TTTCTCACAATTCTGGAGGCTGG + Intergenic
933593032 2:84253651-84253673 TTTCTTACCATTCTGGAGGCTGG - Intergenic
933609740 2:84421730-84421752 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
933649154 2:84835350-84835372 TTTCTCACAGTTCTAGAGGCTGG + Intronic
933650099 2:84843562-84843584 TTTCTCACCATTCTGGAGGCTGG + Intronic
933888880 2:86746676-86746698 TTTCTCTCCTTTCCATAGAATGG + Intronic
934705587 2:96476174-96476196 ATTCTCTGCATTCCAGAGGCCGG + Intergenic
934969298 2:98750136-98750158 TTTCTCACCGTTCTGGAGGCTGG - Intergenic
935104660 2:100029417-100029439 CTTCTCACCATTCTGGAGGCTGG - Intronic
935179574 2:100677470-100677492 TTTCTCACAATTCCGGAGGCTGG + Intergenic
935270311 2:101428455-101428477 TTTCTCACAGTTCCAGAGGCTGG - Intronic
935537141 2:104308016-104308038 TTTCTCACAATTCTGGAGGCCGG + Intergenic
935578479 2:104735197-104735219 TTTCTGACCATTCTGGAGGCTGG - Intergenic
935708354 2:105875725-105875747 TTTCTCACCATTCTGGAGGCTGG - Intronic
935841082 2:107111050-107111072 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
935862683 2:107350120-107350142 TTTATCACCACTTCAGGGGATGG - Intergenic
935865108 2:107379341-107379363 TTTCTCTCTAATCCACAGGAAGG - Intergenic
936490883 2:112971127-112971149 TTTCTCACCATTCTGGAGGCTGG - Intergenic
936708313 2:115102091-115102113 TTTCTCACAGTTCCGGAGGCTGG + Intronic
936826061 2:116582399-116582421 TTTCTTACATTTCCAGAGGCTGG - Intergenic
937088639 2:119189743-119189765 TTTCTCACAGTTCTAGAGGACGG - Intergenic
937270920 2:120651868-120651890 TTTCTCACAGTTCTAGAGGTTGG - Intergenic
937282161 2:120726019-120726041 TTTCTCACCATTCTAGAGGCTGG + Intergenic
937510566 2:122590299-122590321 TTTCTCACCATTTAGGAGGCTGG - Intergenic
937513868 2:122630118-122630140 CTTCTCAGCATTGCAGAGCAGGG - Intergenic
937840966 2:126524296-126524318 TTTCTAACCATTCTGGAGGCTGG + Intergenic
937998272 2:127711697-127711719 TTTCTCACCACCCCTGAGGGTGG + Intronic
938105121 2:128524840-128524862 TTTCTCACAATTCTGGAGGATGG - Intergenic
938132624 2:128730849-128730871 TTGCTCACAGTTCCAGAGGCTGG + Intergenic
938189960 2:129269090-129269112 TTTCTCACAATTCTGGAGGCTGG - Intergenic
938600010 2:132828164-132828186 TTTCTCACAGTTCTAGAGGCTGG - Intronic
938681743 2:133699313-133699335 GCTCTCACCATTCCAGAAGAGGG + Intergenic
938928700 2:136067127-136067149 TATCTCACTGTTCCAGAGGCTGG - Intergenic
939029830 2:137058900-137058922 TTTCTCACAGTTCTAGAGGCTGG - Intronic
939209041 2:139147642-139147664 TTTCTCACAATTCTGGAGGCTGG - Intergenic
939318978 2:140590714-140590736 TTTCTCACAGTTCTAGAGGCTGG - Intronic
939418668 2:141936541-141936563 TTTCTCACTATTCTGGAGGCTGG - Intronic
939660373 2:144881617-144881639 TTTCTCACAGTACCAGAGGCTGG + Intergenic
940031303 2:149264892-149264914 TTTCTCATCATTCTGGAGGCTGG + Intergenic
940285578 2:152029891-152029913 TTTCTCACAGTTCTAGAGGCTGG - Intronic
940521605 2:154757696-154757718 TTTCTCACAGTTCTAGAGGCTGG + Intronic
940537687 2:154967253-154967275 TTTCTCACAATTCTAGAGGCTGG - Intergenic
940848913 2:158670231-158670253 TTTCTCACAGTTCTAGAGGCCGG + Intronic
940980694 2:159999179-159999201 TTTCTCACAGTTCTAGAGGCTGG - Intronic
941086536 2:161124526-161124548 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
941693586 2:168527529-168527551 TTTCTCACAGTTCTAGAGGCTGG + Intronic
941742594 2:169051289-169051311 TTTCTCACCATTCTGGAGGCTGG - Intergenic
941856267 2:170234293-170234315 TTTCTCACAGTTCTAGAGGCTGG + Intronic
942370345 2:175276973-175276995 TTTCTCACAATTCTGGAGGCTGG - Intergenic
942497069 2:176550991-176551013 TTTCTCACAATTCTAGAGGCTGG + Intergenic
942512450 2:176717186-176717208 TTTCTCACCAGTCTAGAGCAGGG + Intergenic
942524983 2:176843488-176843510 TTTCTCACCATTCTAGAGGCTGG + Intergenic
942555956 2:177172415-177172437 TTTCTCACAATTCTGGAGGCTGG - Intergenic
942800952 2:179874740-179874762 TTTATCAACAGTCCAGTGGAAGG + Intergenic
943518062 2:188911022-188911044 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
943546072 2:189280117-189280139 TTTCTCACAATTCTGGAGGTTGG - Intergenic
943781526 2:191829400-191829422 TTTCTCACAATTCTGGAGGCTGG - Intergenic
944225052 2:197341285-197341307 TTTCTCACAATTCTGGAGGTTGG - Intergenic
944430701 2:199630316-199630338 TTTCTCACAATTCTGGAGGCTGG - Intergenic
944584890 2:201164811-201164833 TTTCTCACAGTTCCGGAGGCTGG + Exonic
944653073 2:201851331-201851353 TTTCTCACTGTTCTAGAGGCTGG + Intronic
945363807 2:208926382-208926404 TTTCTCACATTTCCAGAGATTGG - Intergenic
945365459 2:208947351-208947373 TTTCTCACCATTCTGGAGGCTGG - Intergenic
945370844 2:209015490-209015512 TTTCCCACCATTCTAGAGGCTGG - Intergenic
945543820 2:211123842-211123864 TTTCTCACAATTCTGGAGGCTGG + Intergenic
945899743 2:215524385-215524407 TTTCTCACAGTTCCAGAGAATGG - Intergenic
945958050 2:216104802-216104824 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
946013072 2:216582205-216582227 TTTCTCACAGTTCCTGAGGCTGG + Intergenic
946166446 2:217866950-217866972 TTTCTCACCATTTCTGACAAGGG - Intronic
946499909 2:220236508-220236530 TTTCTCACAATTCTGGAGGCTGG + Intergenic
946566819 2:220974738-220974760 TTTCTCACAGTTCCAAAGGTAGG - Intergenic
946658992 2:221979198-221979220 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
946726479 2:222666517-222666539 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
946760370 2:222987895-222987917 TTGCTCACAATTCTAGAGGCTGG + Intergenic
946770680 2:223085543-223085565 TTTCTCACAATTCTGGAGGCTGG + Intronic
946932259 2:224681943-224681965 TTTCTCTCCATTCTGGAGGCTGG - Intergenic
947023615 2:225711934-225711956 TTCCTAACCATTCTAGAGGCTGG + Intergenic
947133072 2:226949702-226949724 TTTCTCACATCTCCAGAGGCAGG + Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
947158394 2:227186828-227186850 TTTCTCACAATTCTGGAGGCTGG + Intronic
947336552 2:229091660-229091682 TTTCTCACCTTTCTGGAGGCTGG - Intronic
947352663 2:229262675-229262697 TCTCTCACCATTTCGGAGGCTGG + Exonic
947540361 2:230973170-230973192 TTACTCAACATTACAAAGGAAGG + Intergenic
947566086 2:231194367-231194389 TTTCTCCCCATCCCAGAAGATGG - Intergenic
947801366 2:232930169-232930191 TTTCTCATAGTTCCAGAGGCTGG + Intronic
947999127 2:234553239-234553261 TTTCTCACAGTTCCAGAGGTTGG - Intergenic
948059621 2:235033202-235033224 TCTCTCACGGTTCCAGAGGCCGG + Intronic
948132410 2:235610374-235610396 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1168915334 20:1480713-1480735 TTTCTCACAATTCTGGAGGCTGG - Intronic
1169078282 20:2776504-2776526 TTTCTCACAGTTCTAGAGGGTGG + Intergenic
1169228882 20:3873742-3873764 TTTCTCACAGTTCTAGAGGCTGG - Exonic
1169578273 20:6990484-6990506 TTTCTCACAGTTCTAGAGGACGG - Intergenic
1169635805 20:7690112-7690134 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1169685149 20:8262716-8262738 TTTCTCACCATTCCAGAGGCTGG + Intronic
1169926683 20:10791647-10791669 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1170023486 20:11863140-11863162 TTGCTCACAATTCTAGAGGCTGG - Intergenic
1170302267 20:14897765-14897787 TTTCCCACCATTCTGGAGGCTGG + Intronic
1170318952 20:15073093-15073115 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1170461253 20:16578766-16578788 TTTCTCACTATTCCAGAAGCAGG - Intergenic
1170628244 20:18045932-18045954 TTTCTCCCCATTTCACAGCATGG + Intronic
1170723082 20:18901339-18901361 TTTCTCACCATCCTGGAGGCTGG + Intergenic
1170742090 20:19067015-19067037 TTCCTCACAGTTCCAGAGGCTGG - Intergenic
1170753874 20:19179267-19179289 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1170979198 20:21195394-21195416 GTTGTCACCATTCCTAAGGATGG + Intronic
1171044648 20:21798417-21798439 TTCTTAACCATACCAGAGGAGGG + Intergenic
1171199357 20:23228558-23228580 TTTCCCACAGTTCCAGAGGCTGG - Intergenic
1171368922 20:24647885-24647907 TTTCTCACAATTCTAGAGGCTGG + Intronic
1171571212 20:26253353-26253375 TTTCTCACAGTTCCATAGGCTGG + Intergenic
1172428425 20:34871937-34871959 CTTCTCACAATTCCAGCAGAGGG + Intronic
1172432178 20:34901393-34901415 TTACTCAGAATGCCAGAGGAGGG - Intronic
1173180552 20:40803520-40803542 TTTCTCACCGTTCCGGAGGCTGG + Intergenic
1173267702 20:41500533-41500555 CTTCTCACCACTCAACAGGAAGG + Intronic
1173378349 20:42511197-42511219 TTTCTCACAGTTCCAGAGACTGG - Intronic
1173444035 20:43101931-43101953 TTTCTCACAATTCTGGAGGCTGG + Intronic
1173678006 20:44854614-44854636 TTTCTCACCATTTTAGAGCCTGG - Intergenic
1174706522 20:52661983-52662005 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1174722327 20:52826338-52826360 TTTCTTATCATTCTAGAGGCTGG + Intergenic
1175069842 20:56324107-56324129 TTTCTCATGATTCAAGAGGCTGG + Intergenic
1175172070 20:57087746-57087768 TTCATCACGAATCCAGAGGAGGG + Intergenic
1175176491 20:57115448-57115470 TTGCTCATCATTCCGGAGGTTGG + Intergenic
1177199797 21:17941780-17941802 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1177255190 21:18652382-18652404 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1177328448 21:19625450-19625472 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1177498436 21:21918739-21918761 TTTCTCACCATGCTGGAGGCTGG + Intergenic
1177576701 21:22966234-22966256 TTTCTCACCGTTCTGGAGGCTGG + Intergenic
1177734339 21:25070174-25070196 TTTCTCACCATTCTAGTGCCTGG - Intergenic
1177781272 21:25624756-25624778 TTTCTCACAGTTCTAGAGGTTGG - Intergenic
1177836220 21:26188871-26188893 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1177932623 21:27303584-27303606 TTTCTCACAGTTCTAGAGGCCGG - Intergenic
1178231470 21:30789851-30789873 TTTCTTACCATTCTGGAGGCTGG - Intergenic
1178306498 21:31495268-31495290 TTTCTCACAGTTCCGGAGGCTGG + Intronic
1178746002 21:35250852-35250874 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1178756799 21:35357764-35357786 TTTCTCACAGTTCCAGAGGCTGG - Intronic
1178792315 21:35711908-35711930 TTTCTCACCGTCCCAGAGGCTGG + Intronic
1178842909 21:36152342-36152364 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1178884217 21:36472686-36472708 TTTCTCACAATTCCGGAGGCTGG + Intronic
1179219574 21:39394554-39394576 TTTCTCACTGTTCCGGAGGCTGG + Intronic
1179254006 21:39699477-39699499 TTTCTCACAGTTCTGGAGGATGG + Intergenic
1179344555 21:40544677-40544699 ATTCTCACAGTTCCAGAGGTGGG - Intronic
1180003691 21:45008634-45008656 TTTCCCACCGTTCTAGAGGCTGG + Intergenic
1180010366 21:45045976-45045998 CTTCTCACAGTTCCAGAGGTTGG + Intergenic
1180016950 21:45093330-45093352 TTTCTCACAACTCCAGGCGAGGG + Intronic
1180236667 21:46464537-46464559 TTTCTCACAGTTCCAGAGGATGG + Intronic
1180573385 22:16750373-16750395 TTTCTCACAGTTCCATAGGCTGG + Intergenic
1180748367 22:18107942-18107964 TTTCTCACAATTCTGGAGGCTGG + Intronic
1181362948 22:22352862-22352884 CTTCCCACCCTTGCAGAGGAGGG - Intergenic
1181384461 22:22533743-22533765 TTTCTCACCACTCTGGAGGCTGG - Intergenic
1181498228 22:23300387-23300409 TTACTCAGCCTTCAAGAGGAAGG - Intronic
1181515705 22:23410666-23410688 TTTCTCACCATTCTACAGGTTGG + Intergenic
1182757287 22:32690311-32690333 TTTCTCATCATTCTGGAGGCTGG - Intronic
1182881980 22:33741659-33741681 TTTCTCACGATGCCACAGGCAGG + Intronic
1182963327 22:34497374-34497396 TTTCTCACAATTCTAGAGGCTGG - Intergenic
1183611916 22:38914417-38914439 TTTCTCACTGTTCCAGAGGCTGG - Intergenic
1183749875 22:39713837-39713859 TTTAGCACCTTTCCAGCGGAAGG + Intergenic
1184313400 22:43663875-43663897 TCTCTCACAATTCCGGAGGCTGG - Intronic
1184808064 22:46809117-46809139 TTTCTCCCAGTTCCAGAGGCTGG + Intronic
1184908820 22:47511809-47511831 TTTCTCATCGTTCCGGAGGCTGG - Intergenic
1184925965 22:47637590-47637612 CTTCTCACCATTCTGGAGGCTGG - Intergenic
949237317 3:1825245-1825267 TTTCTCACAGTTCTAGAGGTTGG - Intergenic
949591176 3:5495927-5495949 TTTTTCACCATTCAGGAGGCTGG - Intergenic
949598946 3:5577954-5577976 TTTCTCACAATTCTGGAGGCTGG - Intergenic
949604362 3:5637135-5637157 TTTCTCACAGTTCTAGAGGTTGG + Intergenic
949668276 3:6367067-6367089 TTTCTCACATTTCCACAGGCTGG - Intergenic
949697639 3:6717653-6717675 TTTCTCACCGTTACGGAGGCTGG - Intergenic
949903352 3:8838119-8838141 TTTCTCACCATTCTGCAGGTTGG - Intronic
949931542 3:9082489-9082511 TTTCTCACAGTTCTAGAGGCTGG - Intronic
949964131 3:9340943-9340965 TTTCTCACAATTCTAGAGGCTGG + Intronic
950130610 3:10543219-10543241 TTTCTCACAATTCTGGAGGTTGG - Intronic
950567392 3:13778396-13778418 TTTCTCATAGTTCTAGAGGATGG - Intergenic
950574648 3:13824744-13824766 TTTATCACCATGACAGACGATGG + Intronic
951114126 3:18839753-18839775 TTTTGAACCCTTCCAGAGGAAGG + Intergenic
951470926 3:23055368-23055390 TTTCTCACTGTTCTAGAGGCTGG + Intergenic
951760358 3:26140773-26140795 TTTCTTACAATTCCAGAGGCTGG - Intergenic
951914007 3:27780532-27780554 TTTCTCACCATTCTGGAAGCTGG - Intergenic
952016540 3:28963512-28963534 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
952104208 3:30050631-30050653 TTTCTCACAATTCTGGAGGCTGG + Intergenic
952111887 3:30133703-30133725 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
952585324 3:34885842-34885864 TTTCTCACAGTTCCGAAGGATGG - Intergenic
952645381 3:35651303-35651325 TTTCTCAGTATTTCAGAGCAAGG - Intronic
952699485 3:36310737-36310759 TTTCTCACTGTTCTAGAGGCTGG - Intergenic
952732782 3:36656776-36656798 ATTGACACCATTCCACAGGATGG + Intergenic
953509417 3:43520321-43520343 TTTCTCACAGTACCAGAGGCTGG + Intronic
955002386 3:54939423-54939445 TTTCTCCACATGCCAGGGGAAGG - Intronic
955184200 3:56699469-56699491 TTTCTCACAGTTCTAGAGGGTGG - Intergenic
955539340 3:59957407-59957429 TTTCTCACCGTTCTGGAGGCTGG - Intronic
956284180 3:67591174-67591196 TTTCCTACCATTCCAGAGAAAGG + Intronic
956371291 3:68564794-68564816 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
956478838 3:69652493-69652515 TTTCTCACAGTTCTAGAGGATGG - Intergenic
956747776 3:72323188-72323210 TTTCTCACAGTTCCAGCGGCTGG + Intergenic
956922262 3:73942415-73942437 TTTATCACCATTTCACAGAAAGG - Intergenic
956991438 3:74770985-74771007 TTTCTCACACTTCTAGAGGCTGG + Intergenic
957143139 3:76387019-76387041 TTTCTCACAGTTCTAGAGGCTGG + Intronic
957246709 3:77724630-77724652 TTTCTCACAGTTCTGGAGGATGG - Intergenic
957452786 3:80401465-80401487 TGCCTCACCAATACAGAGGAGGG - Intergenic
957669183 3:83278518-83278540 TTTCTTACAATTCTAGAGGCTGG - Intergenic
957898796 3:86461077-86461099 TTTCTCAGCGTTCTAGAGGCTGG + Intergenic
958472391 3:94537127-94537149 TTTCTCACAATTCTGGAGGCTGG - Intergenic
958686701 3:97407969-97407991 TTTCTCACAGTTCTAGAGGCTGG + Intronic
958711048 3:97717421-97717443 TTTCTCACAGTTCTAGAGGCTGG + Intronic
958949913 3:100405464-100405486 TTTCTCACAATTCCTGAGGATGG + Intronic
959114862 3:102164658-102164680 TTTTTCTCCATTGCAGAGCAAGG + Intronic
959122344 3:102247530-102247552 TTCCTTAGCACTCCAGAGGATGG + Intronic
959210278 3:103370066-103370088 TGTCTCACAATTCTAGAGGCTGG - Intergenic
959338682 3:105099385-105099407 TTTCTCACAATTCTGGAGGATGG - Intergenic
959442476 3:106395312-106395334 TTTCTCACTGTTCCAGAGGCTGG + Intergenic
959568021 3:107852603-107852625 TTTCTCACGGTTCTAGAGGGTGG - Intergenic
959674021 3:109013983-109014005 TTTCTCACAGTTCTAGAGGCTGG - Intronic
959677088 3:109048615-109048637 TTTCTCACTATTCTGGAGGCTGG + Intronic
959910584 3:111759210-111759232 TTTCTCACCATTCTGGAGGCTGG + Intronic
960035810 3:113102117-113102139 TTTCTCACAATTATAGAGGCTGG + Intergenic
960268354 3:115647289-115647311 TTTCTCACCATTCCAGAGGATGG - Intronic
960381932 3:116973276-116973298 TTTCTCACAATTCTGGAGGCTGG - Intronic
960392078 3:117089951-117089973 TTTCTCACAGTTCTAGAGGCTGG + Intronic
960447666 3:117767245-117767267 TTTATCACAATTCTGGAGGATGG - Intergenic
960593107 3:119384468-119384490 TTTCTCATGGTTCCAGAGGCTGG + Intronic
960671443 3:120158476-120158498 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
960895839 3:122504209-122504231 TTTCTCACAGTTCTAGAGGCTGG + Intronic
961065000 3:123867684-123867706 TTTCTCACAGCTCCAGAGGCTGG - Intronic
961399177 3:126623029-126623051 TTTCTCACAGTTCTAGAGGCTGG - Intronic
961560308 3:127724093-127724115 TGTCTCACAGTTCCAGAGGCTGG - Intronic
961769079 3:129235373-129235395 TTTCTCACAGTTCTAGAGGTTGG + Intergenic
962082759 3:132157853-132157875 TTTCTCACCATTCTGGAGCCTGG - Intronic
962692868 3:137918305-137918327 TTTCTCCCCATTCTGGAGGCTGG - Intergenic
963006752 3:140733597-140733619 TTTCTCACAATTCTGGAGGCTGG + Intergenic
963327317 3:143876947-143876969 TTTCTCACTGTTCTAGAGGCTGG + Intergenic
963734723 3:149007023-149007045 TTTCTCACAGTTCTAGAGGCTGG + Intronic
963743269 3:149100300-149100322 TTTCTCACTATTCTGGAGGCTGG - Intergenic
964340876 3:155707179-155707201 TTTCTCACAATTCTGGAGGCTGG - Intronic
964818406 3:160742276-160742298 TTTCTCAGCCTTACAAAGGAAGG - Intergenic
964885127 3:161473276-161473298 TTTCTCACAATTCTGGAGGCTGG + Intergenic
965000099 3:162942299-162942321 TTTCTCATCATTCTGGAGGATGG - Intergenic
965418295 3:168425148-168425170 TTTCTCACCGTTCTGGAGGCTGG - Intergenic
965715620 3:171599371-171599393 TTTCTGACAATTCCAGAGACAGG - Intergenic
965776895 3:172241304-172241326 TTTCTTACAATTCTAGAGGTTGG + Intronic
965797553 3:172457146-172457168 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
965840098 3:172894890-172894912 TTTCTCATCATTCCAGAGGCTGG - Intronic
966014207 3:175121453-175121475 TATCTTACCTGTCCAGAGGAGGG - Intronic
966453335 3:180086813-180086835 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
966716661 3:183019567-183019589 TTTCTCACGATTCTAGAGGCTGG - Intronic
967131568 3:186475854-186475876 TTTCTTACAGTTCCAGAGGCTGG - Intergenic
967260691 3:187638831-187638853 TTTCTCACTGTTCTAGAGGCTGG + Intergenic
967491550 3:190097190-190097212 ATTCTCACCATTCAAAAGCAAGG + Intronic
967675458 3:192293825-192293847 TTTCTTACAGTTCCAGAGGATGG + Intronic
967708196 3:192676898-192676920 TTTCTCCCCATTCTGGAGGCTGG - Intronic
967863573 3:194172107-194172129 TTTCTCACAATTCTTGAGGCTGG + Intergenic
968256716 3:197280893-197280915 TTTCTCACAATTCTGGAGGCTGG + Intronic
968274846 3:197433015-197433037 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
969271057 4:6102553-6102575 TTTCTTACCATTCTGGAGGCTGG - Intronic
969282817 4:6182595-6182617 TTTCTCACCGTTCTGGAGGCTGG - Intronic
969283488 4:6187672-6187694 TTTCTCACAGTTCTAGAGGCTGG - Intronic
969343960 4:6559815-6559837 TTTCTCACCGTTCTGGAGGCTGG - Intronic
970155638 4:13139270-13139292 TTTCTCATGATTCTAGAGGCTGG - Intergenic
970172666 4:13305178-13305200 TTTCTCACCATTCTGGAGGTTGG + Intergenic
970530584 4:16978211-16978233 TGGGTCACAATTCCAGAGGATGG - Intergenic
970639586 4:18049524-18049546 TTTCTCACAATTCTGGAGGCTGG + Intergenic
970693581 4:18647786-18647808 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
970713147 4:18887875-18887897 TTTCTCACAGTTCTAGAGGGTGG - Intergenic
970974034 4:22022316-22022338 TTTCTCACAATTCTGGAGGATGG - Intergenic
970989877 4:22200460-22200482 TTTCTCACATTTCTAGAGGATGG + Intergenic
971054406 4:22896442-22896464 TTTCTCACCATTCTGGAGGCTGG - Intergenic
971157174 4:24095710-24095732 TTTCTCGCCATTCTGGAGGCTGG + Intergenic
971211637 4:24623377-24623399 TTTCCCACAATTCTAGAGGCTGG - Intergenic
971361110 4:25939498-25939520 TTTCTCACAATTCTGGAGGCTGG - Intergenic
971370775 4:26016978-26017000 TTTCTCACAATTCTGGAGGCTGG - Intergenic
971563048 4:28105809-28105831 TTTGTCTCCCTTCCAGGGGATGG - Intergenic
971635564 4:29052636-29052658 TTTCACCCCATTGGAGAGGAAGG - Intergenic
972102373 4:35437914-35437936 TTTCTCACAATTCTAGAGACTGG + Intergenic
972142296 4:35975989-35976011 TTTCTCACAGTTCTAGAGGTTGG + Intronic
972271567 4:37515278-37515300 TTTCTCACAATTCTGGAGGTTGG - Intronic
972404012 4:38729909-38729931 TTTCTGACAGTTCCAGAGGCTGG + Intergenic
972887238 4:43507724-43507746 TTTTTCACAATTCTAGAGGCTGG - Intergenic
973640204 4:52895027-52895049 TTTCCCTCCAATCTAGAGGATGG - Intronic
973723374 4:53748218-53748240 GTTCTCTCCATTCTAGAGGTAGG - Intronic
973747436 4:53977712-53977734 TTTCTCACCATTCCAGGTACAGG - Intronic
973834689 4:54797409-54797431 TTTCTCACCATTCTAGAGGGAGG - Intergenic
974013735 4:56630192-56630214 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
974221386 4:58977006-58977028 TTTCTCACAATTCTGGAGGCTGG + Intergenic
974231503 4:59121343-59121365 ATTATCAACATTCCAGAGAAAGG - Intergenic
974754268 4:66183396-66183418 TTTCTCACTATTCTAGAGGCTGG + Intergenic
975417492 4:74121980-74122002 TTTCTCACAGTTCTAGAGGCTGG - Intronic
975450425 4:74519145-74519167 TTTCTCACTATTCTGGAGGCTGG + Intergenic
975600440 4:76094166-76094188 TTTCTCATAATTCCAGAGCTGGG - Intronic
975602157 4:76112950-76112972 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
975687769 4:76934267-76934289 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
975800028 4:78051275-78051297 TTTCTCATCATTCTGGAGGCTGG - Intergenic
976000958 4:80372484-80372506 TTTCTCACAACTCCAGAGTTTGG - Intronic
976336666 4:83895772-83895794 TTTCTCACAATTCTGGAGGCTGG + Intergenic
976635273 4:87281123-87281145 TTTCTCACCATTCTGGAGCTGGG - Intergenic
977187345 4:93956008-93956030 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
977448534 4:97163306-97163328 TTTCTCACAATTCTAGAGGCTGG - Intergenic
977633915 4:99273430-99273452 TTTCTCACCATTATGGAGGCTGG - Intergenic
977700030 4:100010992-100011014 TTTATCAGCATTGCACAGGAGGG - Intergenic
977851235 4:101832037-101832059 CTTCTAATCATTCCTGAGGAAGG + Intronic
977879183 4:102184742-102184764 TCTCTCACATTTCCAGAGGCTGG + Intergenic
977954644 4:103012694-103012716 TTTCTCACAATTCTGGAGGCTGG + Intronic
978331345 4:107615970-107615992 TTTCTCACAGTTCTAGAGGTTGG - Intronic
978658351 4:111093826-111093848 TTTCTCACCATTAAATATGATGG - Intergenic
978875545 4:113636563-113636585 TTTCTCACAGTTCCGGAGGCTGG + Intronic
978882959 4:113729922-113729944 TTTCTCACAGTTCTAGAGGCTGG - Intronic
978889953 4:113813407-113813429 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
979005135 4:115284708-115284730 TTTCTCACAATTCTGGAGGCTGG - Intergenic
979157272 4:117412122-117412144 TTTCTCACAGTTCTAGAGGTTGG - Intergenic
979552796 4:122009929-122009951 TGTCTCACAATTCTGGAGGATGG + Intergenic
979601690 4:122592477-122592499 TTTCTCACAGTTCCAGAGGATGG + Intergenic
979613437 4:122714291-122714313 TTTCTCACAGTTCTGGAGGACGG - Intergenic
979748147 4:124242844-124242866 TTTCTCACAGTTCAGGAGGATGG - Intergenic
980429198 4:132668216-132668238 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
980476891 4:133329680-133329702 TTTTTCACCCTTGCAGAGGAAGG - Intergenic
980501062 4:133654892-133654914 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
980802861 4:137775351-137775373 TTTCTCAGAATCACAGAGGAAGG + Intergenic
981016541 4:139979808-139979830 TTTCTCACAGTTCTAGAGGCTGG - Intronic
981047404 4:140278148-140278170 TTTCTCACAGTTCTAGAGGCTGG + Intronic
981052382 4:140322070-140322092 TTTCTCACAGTTCTAGAGGTTGG - Intronic
981132702 4:141175733-141175755 TTTCTCACAATTCTGGAGGCTGG + Intronic
981161399 4:141503331-141503353 TTTCTCACAATTCTGGGGGATGG - Intergenic
981306031 4:143247824-143247846 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
981422515 4:144567425-144567447 TTTCTCACAGTTTCAGAGGCTGG - Intergenic
982425733 4:155257547-155257569 TTTCTCACCATTCCGGAGGCTGG + Intergenic
983031791 4:162811838-162811860 TTTCTCACAGTTCAAGAGGCTGG + Intergenic
983049856 4:163033432-163033454 TTTCTCACAGTTCTAGAGGTTGG - Intergenic
983052548 4:163065674-163065696 TTTTTCATAATTCCAGAGGCTGG - Intergenic
983955457 4:173692544-173692566 TTTCTCACAGTTCTAGAGGATGG - Intergenic
983956615 4:173705548-173705570 TTTCTTACCATTCTGGAGGCTGG - Intergenic
984024653 4:174528733-174528755 TGTCTCACAATTCCTGAGGCTGG + Intergenic
984191139 4:176607064-176607086 TTTCTCACAGTTCCAGAAGCCGG - Intergenic
984194883 4:176647270-176647292 TTTCTCACAATTCTGGAGGCTGG + Intergenic
984506199 4:180622074-180622096 TTTCTTACCATTCTGGAGGCTGG + Intergenic
984523735 4:180831549-180831571 TTTCTCACGATTCTGGAGGCTGG + Intergenic
984790267 4:183608676-183608698 TTTCTCACCATTCTGGAGGCTGG - Intergenic
984841954 4:184077077-184077099 TTGCTCACAATTCCGGAGGCTGG + Intergenic
984863401 4:184259292-184259314 TTTCTCACGGTTCGAGAGGCTGG - Intergenic
984871551 4:184329872-184329894 TTTCTCAAAAGGCCAGAGGATGG - Intergenic
985323559 4:188741272-188741294 TTTCTCACAGTTCTGGAGGATGG - Intergenic
985520871 5:373509-373531 TTTCTCACCAATGCCCAGGAAGG + Intronic
985562483 5:596481-596503 TTTCTCACCATTCTGGAAGCTGG + Intergenic
985584849 5:725365-725387 TTTCTCACCATTCCAGAGCCTGG - Intronic
985598353 5:809679-809701 TTTCTCACCATTCCAGAGCCTGG - Intronic
985606424 5:860578-860600 TTTCTCCCCATTCTGGAGGCTGG + Intronic
986011352 5:3718692-3718714 TTTCTCACTATTCTGGAGGCTGG - Intergenic
986029041 5:3878439-3878461 TTTCTCACATTTCTAGAGGTTGG + Intergenic
986059810 5:4177478-4177500 TGTCTCACCATTCTGGAGGCTGG + Intergenic
986067707 5:4251769-4251791 TTTCAAACCATTCCTGAAGAAGG + Intergenic
986465100 5:8012878-8012900 TTTCTCACAATTCTGGAGGCTGG - Intergenic
986488257 5:8262431-8262453 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
986752045 5:10795996-10796018 TTTCTCACCATTTTGGAGGCTGG + Intergenic
986758657 5:10860213-10860235 TTTCTCACCGTTCTGGAGGCTGG + Intergenic
986768790 5:10952696-10952718 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
987213584 5:15709747-15709769 TTCCTCACCATTCTGGAGGCTGG + Intronic
987220676 5:15787921-15787943 TTTCTCACAGTTCTAGAGGCTGG + Intronic
987255436 5:16145482-16145504 TTTCTCACAGTTCTAGAGGCTGG - Intronic
987299559 5:16585404-16585426 TTTCTCATAATTCCAGTGCAAGG - Intronic
987432980 5:17859573-17859595 TTTCTCACAATTCTGGAGGCTGG + Intergenic
987564680 5:19568758-19568780 TTTCTCACAGTTCTAGAGGCTGG - Intronic
987816314 5:22905558-22905580 TTTCTCACAGTCCCAGAGGCTGG + Intergenic
987824331 5:23008800-23008822 TTTCTCACAGTTCTAGAGGTTGG - Intergenic
987839671 5:23207096-23207118 TTTTTCACAGTTCCAGAGGCCGG + Intergenic
987873534 5:23649961-23649983 TTTCTCATAGTTCCAGAGGCTGG - Intergenic
987953715 5:24710198-24710220 TTACTCACATTTCCAGAGGCGGG - Intergenic
987953732 5:24710495-24710517 TTTCTCACAATTCTGGAGGCTGG + Intergenic
988068094 5:26249624-26249646 TTTCTCACAATTCTGGAGGCTGG + Intergenic
988335173 5:29898221-29898243 TTTCTCACAATTCTGGAGGCTGG - Intergenic
988453081 5:31362660-31362682 ATTCTAGGCATTCCAGAGGAGGG - Intergenic
988748938 5:34175466-34175488 ACACTCATCATTCCAGAGGAGGG - Intergenic
989126180 5:38054415-38054437 TTTCTCCCCTCCCCAGAGGATGG - Intergenic
989142466 5:38215179-38215201 TTTCTCACAGTTCTAGAGGTTGG + Intergenic
989183527 5:38601309-38601331 TTTCTCACAGTTCTAGAGGCTGG - Intronic
989300779 5:39890319-39890341 TTTCTCACATTTCTAGAGGCTGG - Intergenic
989315844 5:40077757-40077779 TTTCTCACAATTCTGGAGGCTGG - Intergenic
989476424 5:41879208-41879230 TTTCTCACAATTCTGGAGGCTGG - Intergenic
989698842 5:44237199-44237221 TTTCTCACAATTCTAGATGCTGG - Intergenic
989728826 5:44623296-44623318 TTTCTCACAATTCCGGATGCTGG - Intergenic
989819432 5:45777418-45777440 TATCTCACAGTTCTAGAGGATGG + Intergenic
990055511 5:51572246-51572268 TTTCTCACCATTCTGGAGGCGGG + Intergenic
990063957 5:51689029-51689051 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
990097523 5:52135519-52135541 TTTCTCTCCATTCCAGAGGGTGG + Intergenic
990459793 5:56020511-56020533 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
990723011 5:58719588-58719610 TGTCTCACAGTTCCAGAGGCTGG + Intronic
990765422 5:59177278-59177300 TTTCTCACAATTCTGGAGGCTGG - Intronic
990905666 5:60800615-60800637 TTTCTCACAGTTCTAGAGGCTGG + Intronic
991162577 5:63521499-63521521 TGTCTCACAATTCTGGAGGATGG - Intergenic
991462948 5:66878619-66878641 TTTCTCAGGGTTCAAGAGGAAGG + Intronic
991644103 5:68783717-68783739 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
991996439 5:72391611-72391633 TTTCTCACAATTCTAGAGGCTGG - Intergenic
992001145 5:72437747-72437769 TTTCTCACAATTCTGGAGGCTGG + Intergenic
992095752 5:73361136-73361158 TTTCTTACAGTTCCAGAGGCTGG + Intergenic
992207898 5:74448826-74448848 TTTCTCACAGTTCTAGAGGCAGG + Intergenic
992881736 5:81117293-81117315 TTTCTCACAATTCTGGAGGTTGG + Intronic
993010623 5:82478490-82478512 TTTCTCACCATTCTGGAGAATGG + Intergenic
993014311 5:82518661-82518683 TTTATCACAGTTCCAGAGGCTGG + Intergenic
993281714 5:85933550-85933572 TTTCTCACCATTCTGGAGGCTGG - Intergenic
993482318 5:88438977-88438999 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
993495875 5:88608289-88608311 TTTCTCACAATTCTAGAGTCTGG - Intergenic
993748011 5:91625781-91625803 TTTCTCACAATTCTAGAGGCTGG - Intergenic
994080554 5:95704730-95704752 TTTCTCACCGTTTTAGAGGCTGG + Intergenic
994369035 5:98948211-98948233 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
994599596 5:101886372-101886394 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
994692719 5:103037687-103037709 TTTTTAACAATTCCAGAGGAGGG - Intergenic
994913628 5:105944815-105944837 TTTCTCACAATTCTGGAGGCTGG - Intergenic
995058291 5:107786711-107786733 TTTCTCACCATTCTGGAGGCTGG - Intergenic
995126479 5:108581777-108581799 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
995275417 5:110272562-110272584 TTTCTCACAATTCTGGAGGCTGG + Intergenic
995593069 5:113719867-113719889 TTTCTCACAATTCTGGAGGCTGG - Intergenic
995621754 5:114033196-114033218 TTTCTCACAGTTCCGGAGGCTGG - Intergenic
996474167 5:123896236-123896258 TTTCTCACAGTTTCAGAGGCTGG + Intergenic
996627469 5:125587042-125587064 TTTCTCATCATTCTAGAGTATGG - Intergenic
996692425 5:126354926-126354948 TTTCTTACCATTCTCGAGGCTGG + Intergenic
997119160 5:131156535-131156557 TTTCTCACAGTTCTAGAGGATGG + Intergenic
997152450 5:131512927-131512949 TTTCTCACTATTCTTGAGGCTGG - Intronic
997205727 5:132048467-132048489 TTTCTCACAGTTCTGGAGGATGG - Intergenic
997668735 5:135653137-135653159 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
998268130 5:140681788-140681810 TTTCTCACAGTTCCAGAGGCTGG - Intronic
998589323 5:143460812-143460834 TTTCTCACTATTACAGTGGGAGG - Intergenic
999130016 5:149275292-149275314 TTTCTCACAGTTCCAGATGCTGG + Intronic
999297246 5:150467406-150467428 TTTCTCACCATTCTAAAGGCTGG - Intergenic
999360338 5:150980196-150980218 TTTCTCACAATTCTGGAGGCTGG - Intergenic
999656634 5:153816993-153817015 TTTTTCCCCTTTCCTGAGGAGGG - Intergenic
999847919 5:155505643-155505665 TTTCTCACCCTTCCAGACTAAGG + Intergenic
1000211565 5:159110967-159110989 TTTCTCACCATTCTGGAAGTTGG - Intergenic
1000503155 5:162078166-162078188 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1000596878 5:163225193-163225215 TTTCTCAGTTTTCCCGAGGATGG - Intergenic
1000920985 5:167136947-167136969 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1001214503 5:169842952-169842974 CTACTGACCATTCCAGAGTAGGG - Intronic
1001501892 5:172243530-172243552 TTTCTCACAATTCTGGAGGCTGG - Intronic
1001534574 5:172489658-172489680 TTTCTCTCCATTTCAGGGGTTGG + Intergenic
1001730257 5:173948696-173948718 TTTCTCACCATTCTGGAGGCTGG + Intronic
1001787275 5:174424567-174424589 GGTCTCACCATGCCAGAGGCTGG + Intergenic
1001833550 5:174810399-174810421 TTTTTCACAATTCTAGAGGCTGG + Intergenic
1001864489 5:175091708-175091730 TTTCTCACCAGTCTGGAGGCAGG - Intergenic
1001971511 5:175958516-175958538 TTTCTCACCTTCCCTGATGAAGG - Intronic
1002245933 5:177885260-177885282 TTTCTCACCTTCCCTGATGAAGG + Intergenic
1002357650 5:178643725-178643747 TTTCTCACCATTCTGGAGGTTGG - Intergenic
1002381831 5:178836202-178836224 TTTCTCACAGTTCTAGAGGTTGG + Intergenic
1002614591 5:180442963-180442985 TTTCTCACAACTCTAGAGGTTGG - Intergenic
1003005089 6:2373726-2373748 TTTGTCACAGTTCCAGAGGCTGG - Intergenic
1003144138 6:3495509-3495531 TTTCTCATGGTTCCAGAGGCTGG - Intergenic
1003402042 6:5798562-5798584 TTTCTTACTATTCTAGAGGCTGG + Intergenic
1003458366 6:6305961-6305983 TTTCTTATCTTTCCAAAGGAAGG + Intronic
1003486762 6:6586837-6586859 TTTCTCACCATTTTGGAGGGTGG - Intergenic
1003521556 6:6862731-6862753 TTTCTCACAGTTCCAGGGGCTGG + Intergenic
1003521814 6:6864485-6864507 TTTCTCACCATTCTGAAGGCTGG - Intergenic
1003628308 6:7764012-7764034 TTTTTCACCATTTCTGAAGACGG - Intronic
1003675537 6:8201166-8201188 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
1003714208 6:8628244-8628266 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1003735928 6:8877733-8877755 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1003875734 6:10434661-10434683 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1003903032 6:10672814-10672836 TTTCTTACCATTCTGGAGGCTGG - Intronic
1004470981 6:15928883-15928905 TTTCTCACCATTCTGGAGGCTGG - Intergenic
1004786366 6:18972448-18972470 TTTCACACCATTTCAGTTGAAGG + Intergenic
1004982747 6:21044864-21044886 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1005023587 6:21441235-21441257 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1005070898 6:21861402-21861424 TTTCTCATCATTTTAGAGGCAGG + Intergenic
1005269851 6:24152174-24152196 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1005510308 6:26506604-26506626 TTTCTCCACATTCCAAAGGAGGG - Intronic
1005904901 6:30253697-30253719 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1005912095 6:30319384-30319406 TTTCTGACAGTTCCAGAGGCTGG - Intergenic
1005921988 6:30410035-30410057 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1006942540 6:37762521-37762543 TTTCTCCCCATTTAAGAAGAGGG - Intergenic
1006987907 6:38188952-38188974 TTTCTCACAGTCCCAGAGGCTGG - Intronic
1007501402 6:42300602-42300624 TTCCTCAGCCTTCCAGAAGAAGG + Intronic
1007818373 6:44541252-44541274 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1007888150 6:45256287-45256309 TTTCTCACCATTCTGGAGACTGG + Intronic
1007923586 6:45632561-45632583 TTTCTCACACTTCCGGAGGCTGG + Intronic
1007939866 6:45770342-45770364 TTTCTCACAATCCTAGAGGCTGG + Intergenic
1008164577 6:48120280-48120302 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1008221742 6:48862812-48862834 TCTATCACCATTCCAGAAGTGGG - Intergenic
1009313134 6:62182137-62182159 TTTCTCACAATTCTAGAGGCTGG - Intronic
1009641052 6:66337358-66337380 TTTCTCACAGTTCTGGAGGATGG + Intergenic
1009873288 6:69474549-69474571 CTTCTCTCCTTCCCAGAGGATGG + Intergenic
1009878617 6:69537669-69537691 TTTCTCACAATTCTGGAAGATGG + Intergenic
1010094810 6:72029572-72029594 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1010367612 6:75069976-75069998 CTTCTCACAATTCTAGAGGTGGG - Intergenic
1010471570 6:76234231-76234253 TTTCTCACCATCCCGGAGGCTGG - Intergenic
1010525831 6:76899289-76899311 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1010562724 6:77370330-77370352 GTTCTCTCCATTCCAGAAAATGG - Intergenic
1011396788 6:86918702-86918724 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1011529884 6:88310459-88310481 TTTCTCACTGTTCTAGAGGCTGG - Intergenic
1011602742 6:89075140-89075162 TTTCTCACACTTCCAGAGACCGG + Intergenic
1012117422 6:95320189-95320211 TTTCTCACCCTTCCAGAAGGGGG + Intergenic
1012510762 6:99999168-99999190 TTTCTCATAATTCCTAAGGATGG - Intergenic
1012520533 6:100116019-100116041 TTTCTCAGCATGCCAGAAGCAGG + Intergenic
1012786041 6:103627130-103627152 TTTCTCACAATTCTAGAGGCTGG - Intergenic
1013340076 6:109205457-109205479 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1013667685 6:112365591-112365613 TTTCTCATCATTCCAAGAGATGG - Intergenic
1013692051 6:112657296-112657318 TTTCTCACAGTTCAAGAGGTTGG - Intergenic
1013768634 6:113601786-113601808 TTTCTCACACTTCTAGAGGCTGG - Intergenic
1014343717 6:120240035-120240057 TTTCTCACACTTCCAGAGGCTGG - Intergenic
1014612612 6:123562557-123562579 TTTCTCACAATTCTGGAGGCTGG - Intronic
1014634229 6:123824999-123825021 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1014698385 6:124652609-124652631 TTTCTCACAATTCTGGAGGCTGG + Intronic
1015086162 6:129294371-129294393 TTTCTCACGATTCTAGAGGCTGG + Intronic
1015275629 6:131380903-131380925 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1015597724 6:134881591-134881613 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1015700175 6:136027150-136027172 TTTCTCACAGTTCCAGAGGCTGG - Intronic
1015820974 6:137259946-137259968 TTTCTCACAGTTCCAGAGACCGG + Intergenic
1016040990 6:139431795-139431817 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1016186742 6:141206745-141206767 TTTATCAGCAGTCCAGAGGGTGG + Intergenic
1016515079 6:144884185-144884207 TTTCTCACAGTTCAAGAGGCTGG - Intergenic
1016536344 6:145110978-145111000 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1016562165 6:145408751-145408773 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1016574923 6:145559065-145559087 ATTTTCACAATTCCAGAGGTAGG + Intronic
1016597475 6:145817503-145817525 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1016808524 6:148237032-148237054 TTTCTCACAGTTCCAGAGGTTGG - Intergenic
1017023918 6:150165042-150165064 TTTCTCACCATTCTGGAAGCTGG - Intronic
1017312294 6:152988096-152988118 TTTCTCACAGTTCTGGAGGATGG + Exonic
1017434310 6:154401453-154401475 TTTCTCACCGTTCTGGAGGCTGG - Exonic
1017807656 6:157960034-157960056 TTTCTCACAGTTCTAGAGGATGG - Intergenic
1017996582 6:159536809-159536831 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1018829201 6:167429604-167429626 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1018926634 6:168211312-168211334 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1019799815 7:3080037-3080059 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1020563682 7:9768653-9768675 TTTCTCACAATTCTAGAGGCTGG - Intergenic
1020639163 7:10734224-10734246 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1020725515 7:11808440-11808462 TTTCTCACAATTCTGGAGGCTGG - Intronic
1020791028 7:12628354-12628376 TTTCTCACCAGTCTGGAGGCTGG + Intronic
1020876376 7:13699919-13699941 TTTCTCACACTTCCGGAGGCTGG + Intergenic
1021022653 7:15623015-15623037 TTTCTCACAGTTCTGGAGGATGG - Intronic
1021152237 7:17165862-17165884 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1021184584 7:17548543-17548565 TTTCTCACAGTTCCAGAGGGTGG - Intergenic
1021891135 7:25187529-25187551 TTTCTCACAGTTCTAGAGGTTGG + Intergenic
1022056206 7:26737160-26737182 TTTTTCACCAGACCAGGGGAGGG - Intronic
1022209902 7:28198168-28198190 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1022462199 7:30620299-30620321 TTTCTCACCGTTCTGGAGGCTGG + Intronic
1022795760 7:33730320-33730342 TTTCTCACCATTCTGAAGGCTGG - Intergenic
1023556019 7:41423704-41423726 TTTCTAACCATTCTGGAGGCTGG - Intergenic
1023603403 7:41903747-41903769 TTTCTCATCATTCTGGAGGCTGG + Intergenic
1023625103 7:42107670-42107692 TTCCTCCACATTCCAGAGGAGGG + Intronic
1023746316 7:43326013-43326035 TTTCTCACCATTCTAAAGGCTGG + Intronic
1023856356 7:44186505-44186527 TTTCTCACTATTCTAGAGGCTGG - Intronic
1024036839 7:45513915-45513937 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
1024210515 7:47199362-47199384 TTTCTCACAGTTCTAGAGAAAGG + Intergenic
1024457330 7:49624252-49624274 TTTCTTACAATTCCAGAGGCTGG - Intergenic
1024640105 7:51321543-51321565 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1024683495 7:51719110-51719132 TTTCTCACGGTTCCAAAGGCTGG + Intergenic
1025300631 7:57817360-57817382 TTTCTCACAGTTCCATAGGCTGG - Intergenic
1026103447 7:67401773-67401795 TTCCTCACAATTCTAGAGGCTGG - Intergenic
1026118346 7:67515183-67515205 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1026645494 7:72164568-72164590 TTTCTCACAGTTCTAAAGGATGG - Intronic
1027385314 7:77653983-77654005 TTTCTCACCATTCTGCATGAGGG - Intergenic
1028293322 7:89095342-89095364 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1028629082 7:92913945-92913967 TTTCTCACAGTCCCAGAGGTTGG - Intergenic
1029193685 7:98789466-98789488 TTTCTCACCATTCTAGAGGCTGG + Intergenic
1029549661 7:101231008-101231030 GATCTCTCCATTCCAGGGGAGGG + Intergenic
1029788945 7:102822328-102822350 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1030458591 7:109803609-109803631 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1030512512 7:110501278-110501300 TTTCTCACCATCCTGGAGGCTGG + Intergenic
1030749293 7:113210904-113210926 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1030938530 7:115616394-115616416 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1031147034 7:118008012-118008034 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1031262165 7:119534519-119534541 TTAGTCACTATTCCAGAGGTGGG + Intergenic
1031277148 7:119740072-119740094 TTTTTCACCATTACATATGATGG + Intergenic
1031283092 7:119830381-119830403 TTTCTCACCGTTCTAGGGGCTGG + Intergenic
1031417893 7:121515183-121515205 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1031938542 7:127762276-127762298 TTTCTCACAGTTTCAGAGGCTGG + Intronic
1031981303 7:128127439-128127461 TTTCTCATCATTCTAGAGGCTGG + Intergenic
1032301239 7:130689278-130689300 TTTCTCACAGTTCCAGAGGCCGG - Intergenic
1032609293 7:133393760-133393782 TTCCTCACATTTCCAGAGGCTGG - Intronic
1032624185 7:133571704-133571726 TTTCTCACTGTTCCAGAGGCTGG + Intronic
1033032177 7:137837736-137837758 TTTCTCATCATTCTGGAGGTTGG - Intronic
1033594339 7:142845358-142845380 TTTCTCACAGTTCTGGAGGACGG - Intergenic
1033987696 7:147246418-147246440 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1034071628 7:148191537-148191559 TTTCTCACATTTCTAGAGGCTGG + Intronic
1034326200 7:150236206-150236228 TTTCTCATCAATCTAGAGGCAGG + Intergenic
1034490188 7:151389031-151389053 TTTCTCACTGTTCCAGAGGCTGG - Intronic
1034688491 7:152995054-152995076 TTTCTCACAGTTCTAAAGGATGG - Intergenic
1034767004 7:153733050-153733072 TTTCTCATCAATCTAGAGGCAGG - Intergenic
1034824326 7:154247981-154248003 TTTCTCACCATTTCGTAGGCTGG + Intronic
1034888916 7:154822280-154822302 TTTCTCACAGTTCCAGAGGGTGG + Intronic
1034914381 7:155024733-155024755 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
1034992923 7:155559560-155559582 TTTCTCACCATTCCGGAGGCTGG + Intergenic
1035334289 7:158115692-158115714 TTCCTCACAATTCCAGGGGTTGG - Intronic
1035347109 7:158208182-158208204 TTTATCACCCTTAAAGAGGAGGG + Intronic
1035639985 8:1177683-1177705 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1035981615 8:4378916-4378938 TTTATCACAATTCCAGGGGCTGG - Intronic
1036119425 8:5999624-5999646 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1036576932 8:10036481-10036503 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1036607531 8:10320681-10320703 TTTCTCACAATTCTGGAGGCTGG + Intronic
1036677563 8:10847589-10847611 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1036725348 8:11215909-11215931 TTTCTCACTGTTCCAGAGGCTGG + Intergenic
1036937149 8:13014332-13014354 TTTCTCACCGTTCTGGAGGCTGG + Intronic
1036994529 8:13640012-13640034 TTTCTCACCGTTCTGGAGGCTGG + Intergenic
1037077392 8:14737571-14737593 TTTCTCATAATTCTAGAGGCTGG + Intronic
1037128583 8:15380718-15380740 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1037130590 8:15404022-15404044 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1037184917 8:16050961-16050983 TTGCTCACAGTTCCAGAGGCTGG - Intergenic
1037453820 8:19043806-19043828 TGTCTCACCATTCTGGAGGCTGG - Intronic
1037459237 8:19092923-19092945 TTTCTCACAGTTCTAGGGGATGG + Intergenic
1037502710 8:19500839-19500861 TTTCTCACAATTACGGAGGCCGG + Intronic
1037717795 8:21414456-21414478 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1037983819 8:23273986-23274008 TTTCTCACCGTTCTAGAGACTGG - Intronic
1038074834 8:24060442-24060464 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1038321933 8:26535086-26535108 TTTCTCACAGTTCTGGAGGATGG + Intronic
1038404485 8:27311337-27311359 TCTCTCAGCGTTCCAGGGGAAGG - Intergenic
1038529264 8:28304432-28304454 TTTCTCACCATTCAGGAGGCAGG + Intergenic
1038571194 8:28664210-28664232 TTTCTCACCATTCTGGAGGATGG + Intronic
1038749579 8:30283081-30283103 GTTTTCCCCATTCCAGAAGATGG + Intergenic
1038937840 8:32272153-32272175 TTTCCCACCATTCTGGAGGCTGG + Intronic
1039108301 8:34013660-34013682 TTTCTCACAATTCTAGAGGCTGG - Intergenic
1039274037 8:35915327-35915349 TTTCTCACAGTTTCAGAGGCTGG + Intergenic
1039686247 8:39804999-39805021 TTTCTCACAATTCTGGAGGTTGG + Intronic
1040036615 8:42876582-42876604 TTTCTCACAGTTCGAGAGGCTGG - Intronic
1040350371 8:46560693-46560715 TTTCTCACCATTCTGGAGGCTGG - Intergenic
1040573490 8:48629931-48629953 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1040623577 8:49117816-49117838 TTTCTCACAGTTCCAGGGGCTGG + Intergenic
1040651655 8:49455818-49455840 TTTCTCATCATTCCAGAGACTGG - Intergenic
1040655531 8:49503089-49503111 TTTCTCACATTTCCAGAGGCTGG - Intergenic
1040705728 8:50124299-50124321 TTTCTCGACATTCTAGAGGCTGG - Intronic
1040801928 8:51351543-51351565 TGTCTCCCCACTCCAGAGGCTGG - Intronic
1040820845 8:51555113-51555135 TGGCTCACAATTCTAGAGGATGG + Intronic
1040832805 8:51696424-51696446 TTTCTCACCGTTCTGGAGGCTGG - Intronic
1040870698 8:52097855-52097877 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1040946631 8:52891942-52891964 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1041117375 8:54553309-54553331 TTTCTCACAGCTCCAGAGGTTGG + Intergenic
1041194621 8:55388452-55388474 TTTTTCACAGTTCCAGAGGCTGG + Intronic
1041403893 8:57474778-57474800 TTTCTCACGATTCTAGAGGTTGG + Intergenic
1041610453 8:59840550-59840572 TTTCTCACAGTTCCGGAGGCTGG - Intergenic
1041629027 8:60063994-60064016 TTTCTCACAATTCTAGAGGCTGG - Intergenic
1041709148 8:60876979-60877001 TTTCTCACCGTTCTGGAGGCTGG - Intergenic
1041834090 8:62192150-62192172 TTTCTCATAGTTCCAGAGGCTGG - Intergenic
1042120315 8:65480275-65480297 TTTTTCACCATTCTAGAGGCTGG - Intergenic
1042449523 8:68928345-68928367 TTTCTCACCATTCTGGAAGTTGG - Intergenic
1042579921 8:70265348-70265370 TTTCTCACAGTTCCGGAGGCAGG - Intronic
1042652870 8:71062299-71062321 TTTCTCACTGTTCCAGAGACTGG + Intergenic
1042807556 8:72788252-72788274 TTTCTCACAATTCTGGAGGGTGG + Intronic
1042855465 8:73262325-73262347 TTTCTGAACATTCCAGACCAAGG + Intergenic
1042917058 8:73885725-73885747 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1042929014 8:73995227-73995249 TTTCTCACAGTTCCGGAGGCTGG - Intronic
1042968666 8:74384002-74384024 ATTCTCATCATTTCAGAGGCAGG - Intronic
1043141237 8:76592902-76592924 TTTCTCACAGTTCTGGAGGATGG + Intergenic
1043382240 8:79715402-79715424 TTTCTCACAGTTCTGGAGGATGG + Intergenic
1043487318 8:80710757-80710779 TTTCTCACAGTTCTAGAGGCAGG - Intronic
1043794667 8:84521314-84521336 TTTCTCACAGTTCCTGAGGTTGG - Intronic
1043957923 8:86383961-86383983 TTTCTCACATATCCAGAGGCTGG + Intronic
1044319182 8:90783192-90783214 TTTCTCACCATTCTGGAGGCTGG - Intronic
1044586803 8:93876015-93876037 TTTCTTACAGTTCCAGAGGCTGG + Intronic
1044684636 8:94815088-94815110 TTTCTCACATTTCTAGAGGCTGG - Intronic
1044835266 8:96289255-96289277 TTGCTCTCCTTTCCGGAGGATGG + Intronic
1045108538 8:98917654-98917676 TTTCTCACGGTTCTAGAGGCTGG - Intronic
1045719637 8:105093105-105093127 TTTCTCACAGTTCCGGAGGCTGG - Intronic
1045809612 8:106206014-106206036 TTTCTCACCCTTCTAGAGGCTGG - Intergenic
1045986689 8:108257318-108257340 TTTATCACAATTCCGGAGGCTGG - Intronic
1046211928 8:111087553-111087575 TTTCTTACAGTTCCAGAGGCTGG + Intergenic
1046418692 8:113949256-113949278 TTTCTCACCATTCTGGAGGCTGG - Intergenic
1046444868 8:114305033-114305055 TTTCTCACTTTTACAGTGGAAGG - Intergenic
1046509297 8:115179681-115179703 TTTCTCACCTTTGCAGAGTCTGG + Intergenic
1046677059 8:117121402-117121424 TTTCTCACAGTTCTAGAGGGTGG + Intronic
1046678505 8:117139477-117139499 TTTCTCACAGCTCCAGAGGATGG - Intronic
1046692979 8:117306866-117306888 TTTTTCACCCTTCCAGTGCAGGG - Intergenic
1046718004 8:117588040-117588062 TTTCTCACAGTGCCAGAGGCTGG - Intergenic
1046794231 8:118353566-118353588 TTTCTCATGGTTCCAGAGGCCGG - Intronic
1047000040 8:120564433-120564455 TTTCTCACAATTCTAGAGGCTGG - Intronic
1047621786 8:126615163-126615185 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1047931442 8:129732244-129732266 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1048019109 8:130521834-130521856 TTTCTCACGGTTCCAGAGCCTGG - Intergenic
1048049516 8:130804228-130804250 TTTCTCACAATTGGAGAGGCTGG + Intronic
1048060886 8:130918193-130918215 TTTCTCACAATTCTGGAGGCTGG + Intronic
1048140920 8:131793477-131793499 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1048276127 8:133067320-133067342 TTTCTCTACACTGCAGAGGAGGG + Intronic
1048313868 8:133347859-133347881 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1048625539 8:136181129-136181151 TTTCTCACCACTCCGGAGGCTGG + Intergenic
1048627235 8:136198588-136198610 TTTCTCACAATTCTGGAGGATGG + Intergenic
1048870073 8:138790130-138790152 TTTCTCACTGTTCCAGAGGCTGG + Intronic
1048932689 8:139327435-139327457 TTTCTCACGCTTCTAGAGGCTGG - Intergenic
1049176590 8:141196631-141196653 TTTCTCCGCATGCCTGAGGAGGG + Intergenic
1049308848 8:141922731-141922753 TTTCTAACAAGTCCAGGGGACGG + Intergenic
1049309130 8:141924133-141924155 TTTCTAACAAGTCCAGGGGACGG - Intergenic
1049840874 8:144770849-144770871 TTTCTCACAATTCCGGAGGCTGG - Intergenic
1050026839 9:1343592-1343614 TTTCTCACTGTTCTGGAGGATGG + Intergenic
1050365968 9:4874066-4874088 TTTCTCACAGTTCTAGGGGATGG - Intronic
1050613102 9:7373442-7373464 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1050647973 9:7742574-7742596 TTTCTCACAGTTCCGGAGGCAGG + Intergenic
1050701789 9:8347888-8347910 TTTCTCACCATTCAGGATGCTGG - Intronic
1050950182 9:11581232-11581254 TATCTCACAGTTCTAGAGGATGG + Intergenic
1051306206 9:15712706-15712728 TATCTCATCCTCCCAGAGGATGG + Intronic
1051551013 9:18329253-18329275 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1051747135 9:20305837-20305859 TTTCTCACAGTCCCAGAGGCTGG + Intergenic
1052306514 9:27016106-27016128 TTTCTCACAGTTCCAGAGCCTGG + Intronic
1052436882 9:28441173-28441195 TTTCTCACAATTCTGGAGGCTGG - Intronic
1052449512 9:28610666-28610688 TTTCTCACAGTTCTGGAGGATGG - Intronic
1052679620 9:31672846-31672868 TTGCTTACCATTCTAGAGGCTGG + Intergenic
1053185821 9:36015559-36015581 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1053277816 9:36796585-36796607 CTTTCCACCTTTCCAGAGGATGG - Intergenic
1053386066 9:37690773-37690795 TTTCTCACAATTCTGGAGGCTGG + Intronic
1055086903 9:72323662-72323684 TCTCTCACAGTTCCAGAGGTTGG + Intergenic
1055146064 9:72936440-72936462 TCTCTCTCCATTCAAGAGGAAGG - Intronic
1055453407 9:76451707-76451729 TTTCTCACAATTCTGGAGGCTGG - Intronic
1055501987 9:76910229-76910251 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1055645740 9:78359802-78359824 TTTTTCACAGTTCCAGAGGCTGG + Intergenic
1055723763 9:79205009-79205031 TTTCTCACAGTTCTAGAGGCCGG - Intergenic
1055928181 9:81532279-81532301 TTTCTCACAGTTCCAGAGACTGG + Intergenic
1056178632 9:84060546-84060568 TTTCTCACAATTCCAGAGGCTGG - Intergenic
1056328656 9:85503493-85503515 TTTCTCACCCTTCTGGAGGCTGG + Intergenic
1056399615 9:86213854-86213876 TTTATCACCATTCCAAATTATGG - Intergenic
1056442631 9:86635874-86635896 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1056737750 9:89224282-89224304 TTTCTCACCATTCTGGAGGCTGG + Intergenic
1056889985 9:90482955-90482977 TTACTCACCATTCTGGAGGCTGG + Intergenic
1056893172 9:90515112-90515134 TTTCTCACAATTCTGGAGGCGGG + Intergenic
1057126630 9:92620953-92620975 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1057263328 9:93598364-93598386 GTTCTCATCCTACCAGAGGATGG + Intronic
1057308766 9:93928251-93928273 TTCCTCACCATTCTGGAGGCTGG + Intergenic
1057624841 9:96667916-96667938 TTGCTGACCATTCCAAGGGAGGG - Intergenic
1057800387 9:98187507-98187529 TTTCTCACAGTTCAGGAGGATGG + Intronic
1057940586 9:99279444-99279466 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1058014468 9:100014893-100014915 TTTCTCATCATTCTGGAGGCTGG + Intronic
1058444227 9:105040356-105040378 TTTCTCACAATTCTAGTGGCTGG + Intergenic
1058882438 9:109297274-109297296 TTTCTCACCATTCTGGAGGCTGG - Intronic
1059058991 9:111015150-111015172 TTTCTCACAATTCTGGAGGCTGG - Intronic
1059362661 9:113757667-113757689 TTTCTCACAGTTCCGGAGGCTGG + Intergenic
1059579588 9:115529888-115529910 TTTCTTCACATTACAGAGGATGG + Intergenic
1059624765 9:116051016-116051038 TTTCTCACAGTTCCGGAGGCAGG - Intergenic
1059987470 9:119834692-119834714 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1060043310 9:120320317-120320339 TTTCTCACCATTTTGGAGGCTGG + Intergenic
1060146002 9:121252962-121252984 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1060254015 9:122010583-122010605 TGTCCCTCCATTGCAGAGGATGG - Intronic
1060853903 9:126899782-126899804 TTTCTCACCGTTCTGGAGGCTGG + Intergenic
1061362498 9:130152534-130152556 TTACTCACGGTTCCAGAGGCTGG + Intergenic
1062162719 9:135088702-135088724 TTCCTCCCCAGTCCATAGGAGGG + Intronic
1203759245 EBV:3467-3489 TTTCCCCCGATTCAAGAGGAGGG + Intergenic
1185726286 X:2424469-2424491 TTCCTCCCAATTCCAGAGGCTGG - Intronic
1185726292 X:2424523-2424545 TTTTTCACAATTCCAGAGGCTGG - Intronic
1186124355 X:6397007-6397029 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1186382918 X:9079953-9079975 TTTCTCAGCATCCCAGAAGAAGG + Intronic
1186439241 X:9571101-9571123 TTTCTCACAATTCTGGAGGCTGG + Intronic
1186651989 X:11571101-11571123 TTTCTCACTGTTCTAGAGGCTGG - Intronic
1186806409 X:13144567-13144589 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1186851694 X:13586438-13586460 TTTCTCACCATTCTGAAGGCTGG + Intronic
1187115672 X:16347740-16347762 TTTCTCACAGTTCTGGAGGATGG - Intergenic
1187280679 X:17856524-17856546 TTTCTCACCGTTCTGGAGGATGG - Intronic
1187316725 X:18202612-18202634 TTTCTCACAGCTCCAGAGGCTGG - Intronic
1187394653 X:18908703-18908725 TTTCTCACAGTTCCGGAGGCTGG - Intronic
1187523605 X:20034735-20034757 TTTCTCACAGTTCCGGAGGCTGG - Intronic
1187762081 X:22598422-22598444 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1188049037 X:25461878-25461900 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1188395968 X:29684204-29684226 TTTCTCACAGTTCTGGAGGATGG + Intronic
1188622253 X:32240485-32240507 TTTCTCACCGTTCTGGAGGCTGG - Intronic
1189211799 X:39290131-39290153 TTTCTCACAATTCAATAGGCTGG + Intergenic
1189385964 X:40537101-40537123 TTTCTCACACTTCCAGAGGCCGG - Intergenic
1189465318 X:41274081-41274103 TTTCTTACCATTCCAGTGATTGG - Intergenic
1189486509 X:41436969-41436991 TTTCTCACTGTTCTAGAGGCTGG + Intergenic
1189638119 X:43034509-43034531 TTTCTCACTGTTCTGGAGGATGG - Intergenic
1189649689 X:43176259-43176281 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1189703620 X:43737418-43737440 TTTCTCACAGTTCTAGAGGCTGG + Intronic
1189774473 X:44458055-44458077 TTTCTTACAATTCTAGAGGCTGG + Intergenic
1189786008 X:44559293-44559315 TTTCTCACAGTTCCAGAGTCTGG - Intergenic
1189894987 X:45645998-45646020 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1189907941 X:45781157-45781179 TGTCTCATGATTCCAGATGATGG - Intergenic
1189958084 X:46297198-46297220 TTGCTCACGATTCCATAGGTTGG + Intergenic
1190156421 X:47996922-47996944 TTTCTCACAGTTCCAGAAGCTGG - Intronic
1190325993 X:49207071-49207093 ATTTTCACCATCCCAGAAGAAGG - Exonic
1190459493 X:50658161-50658183 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1190579763 X:51881027-51881049 CTTCTCACCATTCTGGAGGCTGG + Intronic
1190723367 X:53170249-53170271 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1191876709 X:65805397-65805419 TTTCTCACAATTCCGGAGGCTGG + Intergenic
1192594199 X:72388916-72388938 TTTCTCACAATTCTGGAGGCTGG - Intronic
1193797485 X:85893768-85893790 TTGCTCACAATTCTAGAGGCTGG - Intronic
1194056346 X:89138205-89138227 TTTCTTACCATTCCAGATGCTGG - Intergenic
1194629333 X:96264415-96264437 TTTCTCACAGTTCTAGAGGCTGG + Intergenic
1194740711 X:97570670-97570692 TTTCTCACTGTTCAACAGGAAGG + Intronic
1195760736 X:108243538-108243560 TTTCTCACAATTCTAGAAGCTGG - Intronic
1195968586 X:110451131-110451153 GTACACACCACTCCAGAGGATGG - Exonic
1196145232 X:112309161-112309183 TTTCTCACACTTCTGGAGGATGG + Intergenic
1196183932 X:112725403-112725425 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1196436087 X:115675892-115675914 TTTCTCACAGTTCCGGAGGCTGG - Intergenic
1196538161 X:116872336-116872358 TTTCTCACCATTCTGGAGAATGG + Intergenic
1196661375 X:118273749-118273771 TTTCTCACAATTCTGGAGGCAGG - Intergenic
1196881177 X:120199397-120199419 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1196939087 X:120758163-120758185 TTTCTCATAGTTCCAGAGGCTGG - Intergenic
1197071582 X:122305202-122305224 TATCTATCCATTTCAGAGGAAGG + Intergenic
1197339185 X:125244796-125244818 TTTCTCACAATTCTGGAGGCTGG - Intergenic
1197358771 X:125471497-125471519 TTTCTCACAGTTCCAGAGGCTGG + Intergenic
1197426860 X:126307632-126307654 TTTCTTACAATTCAAGAGGCTGG + Intergenic
1197578417 X:128251877-128251899 TTTCTCACAGTTCCAGAGGCTGG - Intergenic
1197970191 X:132107486-132107508 TTTCTCACATTTCTAGAGGCTGG + Intronic
1198420698 X:136468694-136468716 TTTCTCACAGTTCTAGAGGCTGG - Intergenic
1198794659 X:140382802-140382824 TTTCTCACAGTTGCAGAGGCTGG + Intergenic
1199133412 X:144222275-144222297 TTTCTCACCGTTCTACAGGAGGG + Intergenic
1199156654 X:144557311-144557333 TTTCTCACAATTCTGGAGGCTGG + Intergenic
1199551232 X:149063832-149063854 TTTCTCACAGTTCCAGAGTCTGG + Intergenic
1199611161 X:149615889-149615911 TTCCTCACAGTTCCAGAGGCTGG + Intronic
1199748384 X:150791135-150791157 TTTCTCACAGTTCTAGAGGCTGG - Intronic
1200304824 X:155013739-155013761 TTTCTCACAGTTCCGGAGGCTGG + Intronic
1200783508 Y:7238149-7238171 TTGCTCACAGTTCCAGAGGCTGG - Intergenic
1200979322 Y:9247771-9247793 TTTCTGGCCATGGCAGAGGATGG + Intergenic
1201503814 Y:14675653-14675675 TTTCTCATAGTTCCAGAGGCTGG + Intronic
1201526191 Y:14937032-14937054 CTTCTCACCACGCCAGTGGAAGG + Intergenic