ID: 960269190

View in Genome Browser
Species Human (GRCh38)
Location 3:115656080-115656102
Sequence AGGTAGCCCCAGCTCTATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960269182_960269190 12 Left 960269182 3:115656045-115656067 CCCTGGGGACATAAACAAAAACA 0: 1
1: 0
2: 3
3: 48
4: 476
Right 960269190 3:115656080-115656102 AGGTAGCCCCAGCTCTATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 111
960269178_960269190 29 Left 960269178 3:115656028-115656050 CCTTCTCATACTCTGTGCCCTGG 0: 1
1: 0
2: 4
3: 42
4: 310
Right 960269190 3:115656080-115656102 AGGTAGCCCCAGCTCTATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 111
960269183_960269190 11 Left 960269183 3:115656046-115656068 CCTGGGGACATAAACAAAAACAC 0: 1
1: 0
2: 0
3: 18
4: 252
Right 960269190 3:115656080-115656102 AGGTAGCCCCAGCTCTATCTGGG 0: 1
1: 0
2: 0
3: 7
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960269190 Original CRISPR AGGTAGCCCCAGCTCTATCT GGG Intronic
902987886 1:20166473-20166495 AGGTAGCCCCCACTCTCTCAGGG + Intronic
904836478 1:33340751-33340773 AGGCAGGCTGAGCTCTATCTGGG + Intronic
906017046 1:42591419-42591441 AGGCAGCCTGAGCTGTATCTGGG - Intronic
916401041 1:164448747-164448769 AGGTAGTCTGAGCTGTATCTAGG + Intergenic
917235645 1:172888876-172888898 GGTTAGCCCGAGCTCTACCTGGG + Intergenic
919914110 1:202129549-202129571 AGGAAGGCCCAGCTGCATCTGGG - Exonic
920073647 1:203321412-203321434 AGGTAGACCCAGTACTACCTGGG - Intergenic
920786272 1:209044749-209044771 AGGCAGCCCCAGCTGAATCCAGG - Intergenic
921969578 1:221133274-221133296 AGGTAGCCCCACATTTATTTTGG - Intergenic
923183128 1:231542552-231542574 AGGTAGCCCAAGAGCTATCAGGG + Exonic
924282799 1:242454960-242454982 AGGGAGCCCCAGCACAATCAGGG + Intronic
1063014043 10:2057184-2057206 AGGCAGACCCACCTCAATCTGGG + Intergenic
1069805017 10:71116763-71116785 TGGCAGCCCAAGCTTTATCTGGG - Intergenic
1069951205 10:72019573-72019595 GGCAAGCCCCAGCTCTCTCTTGG + Intergenic
1070238561 10:74655563-74655585 AGGTACCCCCACCTCTTTCTTGG - Intronic
1070543716 10:77436266-77436288 AAGTTAGCCCAGCTCTATCTGGG - Intronic
1072831581 10:98663948-98663970 GGGTAGGCTCAGCTCTATGTTGG + Intronic
1073329433 10:102661011-102661033 GGGCAGCCCCAGCTCTTTCTGGG - Intergenic
1077012751 11:386103-386125 AGCTGCCCCCAGCTCCATCTTGG - Intergenic
1079237904 11:18702667-18702689 AAGTAGCCCCATCTCTCTCTCGG + Exonic
1081291026 11:41326103-41326125 AGGCAGACCCACCTCAATCTTGG + Intronic
1082071697 11:47944505-47944527 AGTTACCCCCAGCTGAATCTTGG + Intergenic
1084101139 11:66950443-66950465 AGGTACTCCCAGCACTACCTCGG - Intronic
1084498698 11:69521496-69521518 AGGCTGCTCCAGCTCTAGCTGGG - Intergenic
1091965219 12:4735011-4735033 AGATAGCCCCTGCTCTGTCCAGG - Intronic
1093858084 12:24129594-24129616 TGGCAGCCCCAGCTCTACATTGG - Intergenic
1097045118 12:56181872-56181894 TGGAAGCCACAGCTCTGTCTGGG + Intronic
1102797827 12:115704213-115704235 TGGTGGGCCCATCTCTATCTGGG + Intergenic
1106209632 13:27629846-27629868 AGGTAGCCAGGGCTCAATCTAGG + Intronic
1109616198 13:64837081-64837103 TAATAGCCCCAGCTGTATCTTGG - Intergenic
1111102501 13:83606253-83606275 TGGTAGCCCAAGCAATATCTGGG - Intergenic
1113812538 13:113151289-113151311 AGGGAGGCCCAGCTCTGTTTCGG + Intergenic
1114504701 14:23200650-23200672 CGGAAGCCCCAGATTTATCTTGG - Intronic
1116864696 14:50022206-50022228 AGCTGGCCCCAGATCTATCAAGG - Intergenic
1118755260 14:68838494-68838516 TGGTAGCCCAAGCTGTACCTGGG - Intergenic
1121096363 14:91220549-91220571 TGGAGGCCCCAGCTCTGTCTTGG - Intronic
1122206003 14:100148354-100148376 AGGTAACTCCAGCTCTTTCCAGG + Intronic
1128326392 15:66726639-66726661 AGGTAGCACCACCCCTACCTGGG + Intronic
1130707605 15:86247955-86247977 AGGCGTTCCCAGCTCTATCTGGG - Intronic
1132395306 15:101468755-101468777 AGGAAGGCACAGCTCTCTCTAGG + Intronic
1139923682 16:70474413-70474435 AGGGAGCCCCACCTCTCTCTGGG - Intronic
1145065347 17:19757985-19758007 AGGTACCCCCATCTCCATCAGGG + Intergenic
1146490121 17:33275025-33275047 AGGTACCCTGAGCTCTCTCTAGG - Intronic
1149272373 17:54994207-54994229 AGCTAGTCCCATATCTATCTGGG + Intronic
1152801186 17:82331338-82331360 GCGTGGCCCCAGCTCTGTCTGGG + Intronic
1156154720 18:34287946-34287968 TGGTGGCCCCAGCTGTACCTGGG + Intergenic
1162330014 19:10021987-10022009 AGGAAGCCACAGCTGTCTCTGGG + Exonic
1162872801 19:13598939-13598961 ACGTACTCCCAGCCCTATCTAGG + Intronic
1163011441 19:14429077-14429099 TGGTTTCCCCAGCTCCATCTGGG + Intergenic
1164746882 19:30622901-30622923 AGGAAGCCCCTGCCCCATCTTGG + Intronic
929269504 2:39958337-39958359 AGGCAGGCCCACCTCAATCTGGG - Intergenic
929773543 2:44913380-44913402 AGAAAGCCCCAGCTCTCTCCTGG + Intergenic
931358222 2:61555550-61555572 AGGCAGCCCCAGCTCTCCCTTGG - Intergenic
932260995 2:70327320-70327342 AGGTAGCCTCAGCTGTCCCTTGG - Intergenic
933261177 2:80133213-80133235 AGGTAGCCCCAGTTGTTCCTTGG - Intronic
937377502 2:121347699-121347721 AGGTAGCCCCAGCTGGGTGTGGG - Intronic
938755324 2:134373883-134373905 AGGTTGCTCCAGCTTCATCTTGG + Intronic
943155949 2:184177111-184177133 AGGTAGCTCTGGCTTTATCTAGG + Intergenic
947915958 2:233831609-233831631 AGATTGCCACAGCTCTTTCTTGG + Intronic
1168951423 20:1804537-1804559 GTCTAGCCCCAGCTCTCTCTTGG - Intergenic
1169061019 20:2660396-2660418 AGGTAGCCCCTGTACTTTCTTGG - Intronic
1169510815 20:6261961-6261983 AGGCAGACCCACCTCCATCTGGG + Intergenic
1175661067 20:60812947-60812969 ATGTACACACAGCTCTATCTTGG - Intergenic
1183734474 22:39636239-39636261 AGATGGCCCCAGCCCTGTCTCGG + Intronic
1183961514 22:41414210-41414232 AGGGAGCCCCAGCTCCGCCTGGG + Intergenic
1184469844 22:44690228-44690250 AGGGATCCCCAGCTCTGTGTGGG + Intronic
1184691982 22:46121622-46121644 AGGGAGGCCCAGGTCTCTCTAGG + Intergenic
949341238 3:3033239-3033261 AGGTTACATCAGCTCTATCTAGG + Intronic
950504897 3:13388578-13388600 AGGCAGCCCCAGCCCTGACTAGG - Intronic
950640586 3:14345842-14345864 AGATAGCCGCTGCTCTGTCTGGG - Intergenic
955080476 3:55653870-55653892 TGCTGGCCCCAGCTCTTTCTTGG + Intronic
960269190 3:115656080-115656102 AGGTAGCCCCAGCTCTATCTGGG + Intronic
968579089 4:1381411-1381433 AGGTGGCCACAGCTCTGTCCAGG + Intronic
968580057 4:1385589-1385611 AGGTGGCCCCAGCCCCACCTTGG - Intronic
970124409 4:12792969-12792991 TGGTAGACCAAGCTCCATCTAGG + Intergenic
970673644 4:18423370-18423392 AGAGAGCACCTGCTCTATCTTGG + Intergenic
970865212 4:20750442-20750464 AGGGAGCCCCTACTCTGTCTGGG + Intronic
971003257 4:22346308-22346330 AAGTAGCCCCATCTGCATCTGGG - Intronic
977127521 4:93188343-93188365 AGGCAGCCCAAGCTGTACCTGGG + Intronic
977139382 4:93348618-93348640 AGGTAACCCCAGCACAGTCTGGG - Intronic
977209758 4:94205731-94205753 ATGTTGCCCCAGCTCTGCCTTGG + Intergenic
982904515 4:161050606-161050628 AGGCAGACCCACCTCAATCTGGG - Intergenic
983356383 4:166663379-166663401 AGGTAGCCTCAGGTATTTCTTGG - Intergenic
999376122 5:151087435-151087457 AGGTTGCCCCAGCCCATTCTCGG - Intronic
999997426 5:157105670-157105692 ATGTAAACTCAGCTCTATCTGGG + Intronic
1001173829 5:169446415-169446437 AGGCAGACCCACCTCAATCTCGG + Intergenic
1001731463 5:173963676-173963698 AGGAAGCGCCAGGTCTTTCTTGG - Intergenic
1006044943 6:31287479-31287501 AGCTAGCCCCAGCACTGCCTTGG + Intronic
1006869712 6:37240371-37240393 AGGAAGCCACAGTTCTTTCTTGG + Intronic
1007050478 6:38823324-38823346 ATGTAGACCCAGCTGTATTTCGG + Intronic
1008189583 6:48438627-48438649 TGGTGGCCTGAGCTCTATCTAGG - Intergenic
1012240609 6:96867585-96867607 AGACAGTACCAGCTCTATCTGGG + Intergenic
1015658465 6:135546605-135546627 AGGGAGCCCCAGTTCCATCAAGG + Intergenic
1019175250 6:170156308-170156330 ATTTAGCCCCAGCTTTATCACGG - Intergenic
1020586637 7:10078485-10078507 GGGTAGCCACAGCTGTAGCTGGG - Intergenic
1022087129 7:27079321-27079343 AGGAAGCTCCAGCTAAATCTTGG + Intergenic
1022258540 7:28682692-28682714 GGGAAACCCCAGCTCTCTCTAGG + Intronic
1023579141 7:41662968-41662990 GGGAAGCCCCAGCTCAATCCTGG - Intergenic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1033470678 7:141646277-141646299 AGGTAACTCAACCTCTATCTCGG - Intronic
1033753575 7:144379098-144379120 TGGTAGCCCCAGCTGTTCCTTGG + Intronic
1037009163 8:13819378-13819400 ATGCAGCACAAGCTCTATCTGGG + Intergenic
1038500883 8:28042549-28042571 AGAGAGCCCCACCTCTACCTGGG - Intronic
1042217422 8:66439814-66439836 ATGAAGCCCCAGCTCTTACTGGG - Intronic
1042347876 8:67746398-67746420 AGGGAGGCCCAGCCCTTTCTAGG - Intergenic
1042719873 8:71815799-71815821 AGTCAGACCCAGCTCTAACTTGG - Intergenic
1047317449 8:123747700-123747722 AGGTTGCCCCAGCTATAAATAGG + Intergenic
1049763559 8:144342367-144342389 AGGCACCCCCAGCTCAAGCTGGG - Intergenic
1050707170 9:8414743-8414765 AGGTAGAACCAGCTCTACCTTGG - Intronic
1053075749 9:35132931-35132953 AGGGAGCCCCAAGTTTATCTTGG + Intergenic
1056499185 9:87190922-87190944 AGGAAGCCCCACCTCTGTATGGG - Intergenic
1062076750 9:134593924-134593946 AGGTAGCCCCGGGTCTGTGTGGG + Intergenic
1203776244 EBV:74757-74779 GGGCAGGCCCAGATCTATCTCGG - Intergenic
1193184276 X:78493880-78493902 TGGTAGCCCCAGCCATTTCTGGG - Intergenic
1195270859 X:103229267-103229289 AGGCAGACCCACCTCAATCTGGG - Intergenic
1195949288 X:110250327-110250349 ATCTAGCACCAGGTCTATCTTGG + Intronic
1197762041 X:130034788-130034810 AGGCAGCCCCAGGGCAATCTGGG - Intronic
1197992068 X:132329065-132329087 AGGTAGCCCAAGCTGCAGCTGGG + Intergenic
1198642574 X:138772823-138772845 AGGTAACACCAGCTTTATGTAGG - Intronic