ID: 960275819

View in Genome Browser
Species Human (GRCh38)
Location 3:115728105-115728127
Sequence ATGGAGAGACAGCATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960275811_960275819 17 Left 960275811 3:115728065-115728087 CCAGCCTAGGAACATTGGAGTGT No data
Right 960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG No data
960275812_960275819 13 Left 960275812 3:115728069-115728091 CCTAGGAACATTGGAGTGTTCAC No data
Right 960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960275819 Original CRISPR ATGGAGAGACAGCATGAGGG AGG Intergenic
No off target data available for this crispr