ID: 960276968

View in Genome Browser
Species Human (GRCh38)
Location 3:115739686-115739708
Sequence TGCTCCTGAATGATACCCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960276968_960276970 6 Left 960276968 3:115739686-115739708 CCAGCGGGTATCATTCAGGAGCA No data
Right 960276970 3:115739715-115739737 TTAAATTCCATGTAGTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960276968 Original CRISPR TGCTCCTGAATGATACCCGC TGG (reversed) Intergenic
No off target data available for this crispr