ID: 960278328

View in Genome Browser
Species Human (GRCh38)
Location 3:115752419-115752441
Sequence CTGGGAGAATGGAATCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960278323_960278328 12 Left 960278323 3:115752384-115752406 CCAAACATATGTTTAATTGGTGT No data
Right 960278328 3:115752419-115752441 CTGGGAGAATGGAATCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960278328 Original CRISPR CTGGGAGAATGGAATCAAGT TGG Intergenic
No off target data available for this crispr