ID: 960279083

View in Genome Browser
Species Human (GRCh38)
Location 3:115760906-115760928
Sequence AGACCCACTCCTGTTTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960279083_960279085 1 Left 960279083 3:115760906-115760928 CCATTAGAAACAGGAGTGGGTCT No data
Right 960279085 3:115760930-115760952 CTACAACATATGTGTCTGCTGGG No data
960279083_960279084 0 Left 960279083 3:115760906-115760928 CCATTAGAAACAGGAGTGGGTCT No data
Right 960279084 3:115760929-115760951 GCTACAACATATGTGTCTGCTGG No data
960279083_960279087 23 Left 960279083 3:115760906-115760928 CCATTAGAAACAGGAGTGGGTCT No data
Right 960279087 3:115760952-115760974 GCAGACTGGCTGATTACCACTGG No data
960279083_960279086 9 Left 960279083 3:115760906-115760928 CCATTAGAAACAGGAGTGGGTCT No data
Right 960279086 3:115760938-115760960 TATGTGTCTGCTGGGCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960279083 Original CRISPR AGACCCACTCCTGTTTCTAA TGG (reversed) Intergenic