ID: 960280611

View in Genome Browser
Species Human (GRCh38)
Location 3:115777652-115777674
Sequence CACTACTGGACAGCTGCTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960280611_960280617 18 Left 960280611 3:115777652-115777674 CCATAAGCAGCTGTCCAGTAGTG No data
Right 960280617 3:115777693-115777715 TTTTGTCCAAAGACTATGGCTGG No data
960280611_960280618 21 Left 960280611 3:115777652-115777674 CCATAAGCAGCTGTCCAGTAGTG No data
Right 960280618 3:115777696-115777718 TGTCCAAAGACTATGGCTGGAGG No data
960280611_960280616 14 Left 960280611 3:115777652-115777674 CCATAAGCAGCTGTCCAGTAGTG No data
Right 960280616 3:115777689-115777711 AATCTTTTGTCCAAAGACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960280611 Original CRISPR CACTACTGGACAGCTGCTTA TGG (reversed) Intergenic
No off target data available for this crispr