ID: 960280622

View in Genome Browser
Species Human (GRCh38)
Location 3:115777744-115777766
Sequence AGGTGTGACCCTTTATCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960280619_960280622 22 Left 960280619 3:115777699-115777721 CCAAAGACTATGGCTGGAGGTGT No data
Right 960280622 3:115777744-115777766 AGGTGTGACCCTTTATCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960280622 Original CRISPR AGGTGTGACCCTTTATCATA AGG Intergenic
No off target data available for this crispr