ID: 960280716

View in Genome Browser
Species Human (GRCh38)
Location 3:115778784-115778806
Sequence AATTGGCCACAAGCCCTCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960280716_960280718 -4 Left 960280716 3:115778784-115778806 CCATTGAGGGCTTGTGGCCAATT No data
Right 960280718 3:115778803-115778825 AATTCTGACTTTAACTTCTTTGG No data
960280716_960280719 6 Left 960280716 3:115778784-115778806 CCATTGAGGGCTTGTGGCCAATT No data
Right 960280719 3:115778813-115778835 TTAACTTCTTTGGTAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960280716 Original CRISPR AATTGGCCACAAGCCCTCAA TGG (reversed) Intergenic
No off target data available for this crispr