ID: 960282215

View in Genome Browser
Species Human (GRCh38)
Location 3:115792093-115792115
Sequence GCTCGTGGTCTCGCTGGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960282215_960282221 -8 Left 960282215 3:115792093-115792115 CCGAAGCCAGCGAGACCACGAGC No data
Right 960282221 3:115792108-115792130 CCACGAGCCCACCGGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960282215 Original CRISPR GCTCGTGGTCTCGCTGGCTT CGG (reversed) Intergenic
No off target data available for this crispr