ID: 960284370

View in Genome Browser
Species Human (GRCh38)
Location 3:115810718-115810740
Sequence CAGGGCCAACAGGAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 1, 2: 5, 3: 80, 4: 566}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960284370_960284375 -5 Left 960284370 3:115810718-115810740 CCAGCCTCCTCCTGTTGGCCCTG 0: 1
1: 1
2: 5
3: 80
4: 566
Right 960284375 3:115810736-115810758 CCCTGCCCGAAGTAACTCTCTGG 0: 1
1: 0
2: 0
3: 3
4: 104
960284370_960284378 -3 Left 960284370 3:115810718-115810740 CCAGCCTCCTCCTGTTGGCCCTG 0: 1
1: 1
2: 5
3: 80
4: 566
Right 960284378 3:115810738-115810760 CTGCCCGAAGTAACTCTCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 56
960284370_960284381 13 Left 960284370 3:115810718-115810740 CCAGCCTCCTCCTGTTGGCCCTG 0: 1
1: 1
2: 5
3: 80
4: 566
Right 960284381 3:115810754-115810776 TCTGGGGCCAGCACTCGTTAAGG 0: 1
1: 0
2: 0
3: 5
4: 81
960284370_960284377 -4 Left 960284370 3:115810718-115810740 CCAGCCTCCTCCTGTTGGCCCTG 0: 1
1: 1
2: 5
3: 80
4: 566
Right 960284377 3:115810737-115810759 CCTGCCCGAAGTAACTCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 57
960284370_960284383 26 Left 960284370 3:115810718-115810740 CCAGCCTCCTCCTGTTGGCCCTG 0: 1
1: 1
2: 5
3: 80
4: 566
Right 960284383 3:115810767-115810789 CTCGTTAAGGTTCCAAGCATTGG 0: 1
1: 0
2: 0
3: 2
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960284370 Original CRISPR CAGGGCCAACAGGAGGAGGC TGG (reversed) Intronic
900228316 1:1543198-1543220 CAGGGCCCACTGGGGAAGGCAGG + Intronic
900302039 1:1982684-1982706 CCGGGCCCACAGGAGGAGGGCGG + Intronic
900748077 1:4374829-4374851 CTTGACCAAGAGGAGGAGGCTGG - Intergenic
901040342 1:6359563-6359585 CAGGGCCCACAGGTGGCAGCCGG - Intronic
901312716 1:8282000-8282022 CAGAGCCACGTGGAGGAGGCGGG - Intergenic
901376201 1:8841275-8841297 CAGGGCCCTCAGGCAGAGGCTGG - Intergenic
901753643 1:11427663-11427685 TAGGGACAACAGGAAGAGGTGGG - Intergenic
901945811 1:12702640-12702662 CAGGGCAAACAGCAGGTGGAGGG - Intergenic
902275576 1:15337121-15337143 CATGGCCACCAGGAGGAAGGGGG + Intronic
902565660 1:17309747-17309769 CAGGGCCACATGGTGGAGGCAGG + Intronic
902780286 1:18700526-18700548 CGGGGCCTGCAGGAGGATGCTGG + Intronic
902955352 1:19921459-19921481 CAGGGCTGAGGGGAGGAGGCAGG - Intronic
903034895 1:20486780-20486802 CAGGGCCTCCAGGAGGGGGAGGG + Intergenic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903375310 1:22862109-22862131 CAGGGCCAGCAAGAAGAGGAAGG + Intronic
903603527 1:24558632-24558654 CAGGAGCAACAGGATGAGGGGGG - Intronic
903664147 1:24996383-24996405 AAGGACCACTAGGAGGAGGCTGG - Intergenic
903701972 1:25255933-25255955 CAGGCCGCACAGCAGGAGGCAGG - Intronic
903928967 1:26851266-26851288 CAGCGCCCTCAGGAGGAGGCAGG + Intronic
904199967 1:28813051-28813073 CAGGGCGGACAGGAGGGTGCTGG + Intronic
904272906 1:29362186-29362208 CAGGGCCTCCGGGAGGAGGCTGG + Intergenic
904275940 1:29384453-29384475 AAAGGCCCACAGGAGGATGCTGG + Intergenic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
905328630 1:37176206-37176228 AAGGTCCAATGGGAGGAGGCTGG + Intergenic
905346991 1:37318100-37318122 CAAGGGCAACGGGAGGAGGAAGG - Intergenic
905388579 1:37621586-37621608 GAGGGACCACAGGAGGAGGAGGG + Intronic
905572561 1:39017251-39017273 CAGGGCCTGGTGGAGGAGGCTGG + Intergenic
905617033 1:39408653-39408675 CCGGGCCAGCGGGAGGAGGGCGG + Intronic
905789884 1:40784181-40784203 CAGAGCGAACAGGGCGAGGCGGG + Exonic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
906660399 1:47577816-47577838 AAAGGCCAGCAGGAGCAGGCCGG - Intergenic
912549939 1:110479055-110479077 CAGGGCCATCAGCATGGGGCAGG + Intergenic
912640673 1:111342623-111342645 CAGAGGCAAAGGGAGGAGGCAGG - Intergenic
913957352 1:143318289-143318311 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
914051666 1:144143653-144143675 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
914127531 1:144822888-144822910 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
915054395 1:153112676-153112698 CGGGGCACACAGGAGGTGGCTGG + Exonic
916745058 1:167678792-167678814 CAGGGACAACAAGAGGGGGCGGG - Intronic
917600277 1:176566733-176566755 AAGTGCAAAAAGGAGGAGGCAGG - Intronic
918750759 1:188266365-188266387 AAGGCCCAACAGGTGGGGGCAGG + Intergenic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920263284 1:204704045-204704067 CGGTGGCCACAGGAGGAGGCTGG + Intergenic
920287898 1:204894546-204894568 GAGGGCCAACAAGAGGTGGTAGG - Intronic
920531913 1:206708275-206708297 CAGGGGAAACAAGAGGTGGCTGG - Intronic
920932950 1:210406077-210406099 CAGGCCCTCCAGGAGGAGGGTGG + Intronic
921379088 1:214505422-214505444 CATGGCCAACAGGAGATGGCTGG + Intronic
922025169 1:221742829-221742851 CAGGGCCCTCCGGAGGACGCAGG - Intergenic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
922668229 1:227490665-227490687 CAGAGGGAAGAGGAGGAGGCAGG - Intergenic
923367976 1:233282205-233282227 CAGGGCAAAGAGGAGGCGTCGGG - Intronic
924246322 1:242088626-242088648 CAGAGCCCACAGCAGGTGGCCGG - Exonic
924527256 1:244863673-244863695 CAGGGCCAGCAGCAGGCGGGAGG - Exonic
924626466 1:245699860-245699882 GAGGGCCTACAGGTGGAGGCTGG + Intronic
1063053241 10:2475937-2475959 CAGGGCCAGCAGGGAGAGCCAGG - Intergenic
1063464548 10:6234271-6234293 CAGGGCTCACAGCAGAAGGCAGG - Exonic
1063469473 10:6272836-6272858 CAGGGTCAGATGGAGGAGGCAGG + Intergenic
1064063274 10:12157999-12158021 CAGGGCCGACTGGAGGATGATGG - Exonic
1064092310 10:12395525-12395547 AAGGGCCACCAGGATCAGGCTGG + Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1064706112 10:18074164-18074186 GAGGGAGAAAAGGAGGAGGCAGG + Intergenic
1065915285 10:30349909-30349931 AAGGGGCACCAGGAGCAGGCAGG + Intronic
1066366523 10:34782304-34782326 CAGCGCCCAGTGGAGGAGGCTGG - Intronic
1066471891 10:35706625-35706647 GAGGGCCTACAGGAGGTGGAGGG - Intergenic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069778170 10:70938759-70938781 CAGGTCCAGCAGGAGGTGCCGGG - Intergenic
1069870030 10:71527443-71527465 CAGGGCCCAGAGGAGGAGGCTGG - Intronic
1070256026 10:74813699-74813721 GAGGGCGAGCAGGAGGCGGCGGG + Intergenic
1070301339 10:75205922-75205944 GAAAGCCAACAGGTGGAGGCTGG - Intergenic
1070569714 10:77631783-77631805 CAGGCCAAACAGCAGGGGGCAGG + Intronic
1071147093 10:82588352-82588374 CAGGGGCAAGAGAAGGAGGCAGG - Intronic
1072007711 10:91270419-91270441 CAGGGTCAACAAGAGTAAGCTGG - Intronic
1072443908 10:95481213-95481235 CAGGGACAAAAGGAGAGGGCTGG - Intronic
1072740669 10:97907236-97907258 CACGGGCAGCAGGAGGAGGAAGG + Intronic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1074765776 10:116699021-116699043 CAGGGGCAACAGTAGAAGTCAGG + Intronic
1074835081 10:117283966-117283988 CAGCATCAACACGAGGAGGCAGG + Exonic
1075304819 10:121358504-121358526 CAGGGCCAACGCCAGGAGTCAGG + Intergenic
1075427174 10:122350869-122350891 CAGGGCCAGAAGGAGAAGCCTGG - Intergenic
1075668268 10:124245831-124245853 CAGGGACTGCAGGAGGATGCTGG + Intergenic
1075776367 10:124991467-124991489 GAGGGCCAAAAGGACGGGGCTGG + Intronic
1075834630 10:125443183-125443205 CTGGACCAAAAGGAGGAGGTTGG - Intergenic
1075901915 10:126049973-126049995 CAGGGCAGAAAGGAGGTGGCTGG + Intronic
1075940666 10:126388092-126388114 CAGGGCGAGCAGGAGGGCGCGGG + Exonic
1076035581 10:127196425-127196447 CAGGGCCAGGAGGCGGGGGCGGG + Intronic
1076129379 10:128002291-128002313 CAAGGCCATCAGGAGGAAGTGGG + Intronic
1076189412 10:128472480-128472502 TAGGGCCAACAGGAGGCAGGTGG - Intergenic
1076479732 10:130777330-130777352 CAGGGCAGACTGGAGGAGCCTGG + Intergenic
1077010468 11:377047-377069 GAGGGCGAAGAGGAGGAGGAAGG + Exonic
1077018690 11:407902-407924 CAGGGCCAGCAGGACCAGGAGGG + Exonic
1077244530 11:1529778-1529800 CAGGGCCTCCTGAAGGAGGCAGG + Intergenic
1077288735 11:1779154-1779176 CAGAGCCAACAGAGAGAGGCAGG - Intergenic
1077336433 11:2007001-2007023 CAGGGCCAGCAGGCTGAGCCAGG - Intergenic
1077347964 11:2073079-2073101 CCTGGCCGGCAGGAGGAGGCAGG - Intergenic
1077407972 11:2391109-2391131 CAAGGCCAGGAGGAGGAGGAGGG + Intronic
1077425492 11:2474039-2474061 CTGGGCCAGCGGTAGGAGGCTGG - Intronic
1077534995 11:3119749-3119771 CAGGGCCACCAGGTGGGGCCAGG + Intronic
1078401220 11:11029003-11029025 CAGGGCCAAGAGGAGATAGCAGG + Intergenic
1079043573 11:17080245-17080267 CAGTGCCAACAGCAAGAGGAAGG - Intronic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1080381569 11:31777266-31777288 CAGGGTCACAAGGAGGAGGATGG - Intronic
1081252280 11:40850604-40850626 CAGGACCCACTTGAGGAGGCAGG + Intronic
1081567250 11:44267583-44267605 AAGGGCCAAGTGGAGGAAGCGGG - Exonic
1081577795 11:44330045-44330067 CAGGGACCACAGGCTGAGGCTGG + Intergenic
1081738762 11:45423601-45423623 CTGGGCTAAGAGGAGGAGACTGG - Intergenic
1081751339 11:45513383-45513405 ACAGGCCAACAGGAGGAGGGAGG + Intergenic
1081964343 11:47160638-47160660 CAGGGGCAAGAGGAGAAGGCTGG - Intronic
1082809045 11:57467621-57467643 CAGGAGCATCAGCAGGAGGCAGG - Exonic
1082858186 11:57828228-57828250 TAGGGAGAACAGGATGAGGCAGG - Intergenic
1083110344 11:60400169-60400191 CAGGGCCAACTGGGACAGGCAGG - Intronic
1083118547 11:60489368-60489390 AAAGGCCAACAGGAGAAGGAAGG + Intergenic
1083266592 11:61549867-61549889 AAGGGCCCACAAGAGGAGACAGG - Intronic
1083629772 11:64089514-64089536 CATGGATAACAGGAGGAGGCTGG - Intronic
1083791592 11:64989495-64989517 CAGGGGGCACTGGAGGAGGCTGG + Exonic
1083862008 11:65425357-65425379 CTTGGCCACCAGGAGGAAGCTGG - Intergenic
1084274115 11:68043145-68043167 CCGGGCCTGAAGGAGGAGGCGGG - Intronic
1084275759 11:68050216-68050238 CAGGGCCCACAGGCGCAGGTAGG - Exonic
1084432051 11:69116564-69116586 CTGAGCCTTCAGGAGGAGGCTGG + Intergenic
1084945108 11:72634161-72634183 AAGGGGCAGCAGGAGGAAGCGGG + Intronic
1085589570 11:77746548-77746570 TAGGGCCAACAGTAGGAAGTGGG + Intronic
1087056196 11:93938893-93938915 CAGGGGCAAAGGGAGGAAGCAGG - Intergenic
1087743833 11:101919851-101919873 CAGGGCCAACATGAGGTTGAGGG - Intronic
1088397308 11:109382782-109382804 CAGGGCCAGGTGGAGGATGCGGG + Intergenic
1088550775 11:111010324-111010346 CAGGGCCACGAGAGGGAGGCTGG + Intergenic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1088911887 11:114198460-114198482 CTGGGCCAGCAGGAGACGGCTGG - Intronic
1089610545 11:119666322-119666344 CACAGCCAAAATGAGGAGGCAGG + Intronic
1202819417 11_KI270721v1_random:62183-62205 CAGGGCCAGCAGGCTGAGCCAGG - Intergenic
1091645951 12:2272390-2272412 CCGGGGAAGCAGGAGGAGGCAGG - Intronic
1091693916 12:2615612-2615634 TACGGCCAACAGGATGAGGCTGG + Intronic
1091800955 12:3324151-3324173 CTGGGACCACAGGAGGAGGGAGG + Intergenic
1092198990 12:6568336-6568358 TAGGCGCAACAGGAAGAGGCGGG - Intronic
1094208911 12:27869849-27869871 CAGTGCCAGCAGGAGGATGGCGG + Intergenic
1095668411 12:44830747-44830769 CTGGGCCAACATGATGGGGCTGG - Intronic
1095990006 12:48027947-48027969 CCTGGCGCACAGGAGGAGGCTGG + Intergenic
1096180620 12:49548690-49548712 CAGTGCCAATAGGAGCTGGCTGG + Intronic
1097182168 12:57177758-57177780 CAGGGCCGAGGGGAGGGGGCAGG + Intronic
1097287205 12:57887520-57887542 CAGGGTCAACAGGACAAGCCAGG + Intergenic
1097493341 12:60297186-60297208 GAGGGCAACCTGGAGGAGGCTGG - Intergenic
1098268427 12:68746601-68746623 GAGGGCCAGGAGGAGGAGCCTGG - Exonic
1098721534 12:73905130-73905152 CAGGGCCAACAGGTGATGTCTGG - Intergenic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1101762032 12:107666748-107666770 AAGGGCCAACATGAGGAGATGGG - Intergenic
1101836833 12:108301834-108301856 CAGGGCAGAGAGGTGGAGGCTGG - Intronic
1102031424 12:109742048-109742070 CAGGGGCCACAGAAAGAGGCTGG + Intronic
1102519680 12:113470686-113470708 CAGGGCCCACAGGGGTAGGGGGG + Intronic
1103797018 12:123510184-123510206 CAGGACCCACAGCCGGAGGCAGG - Intronic
1104248290 12:127063880-127063902 CAGGGCAGGCAGGAGCAGGCTGG - Intergenic
1104572334 12:129935931-129935953 TATGGACAACAGGAGGAGGTAGG - Intergenic
1104642171 12:130474490-130474512 AAGTGCCAACAGGTGGAGGTGGG + Intronic
1104749588 12:131229861-131229883 CTGCTCCATCAGGAGGAGGCGGG + Intergenic
1104942403 12:132401230-132401252 CCGTCCCTACAGGAGGAGGCTGG + Intergenic
1104954091 12:132455277-132455299 CAGGGCCACCAGGAACAGCCGGG + Intergenic
1104998711 12:132674907-132674929 AAATGCCAACAGAAGGAGGCTGG - Intronic
1105240895 13:18609251-18609273 CAGGGCCACCGGGAGGCGGCCGG - Intergenic
1105270975 13:18875250-18875272 CGGGGCCAACAGCGGGCGGCGGG - Intergenic
1105402242 13:20105876-20105898 CAGCCCCAGCTGGAGGAGGCTGG - Intergenic
1105600748 13:21884842-21884864 CAGGACAAACAGGAGGGGGGTGG + Intergenic
1106174797 13:27321014-27321036 CAGGGCTGAGAGCAGGAGGCTGG + Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106465422 13:30009805-30009827 CATGGCCATCTGGAGGAAGCGGG + Intergenic
1106694030 13:32150979-32151001 CTGGGCCAATGGGAGGGGGCAGG + Intronic
1107302042 13:38976221-38976243 CAGGGCCACCAGGAGAATGTGGG - Intronic
1107688416 13:42927443-42927465 GAGGGCTAGCAGGAGGAGGGAGG - Intronic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1113285636 13:108845461-108845483 CAGGGCGGACAGCAGGAGGCAGG + Intronic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1113628498 13:111864055-111864077 CAGGGCCCACAGGAGGCTTCTGG + Intergenic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1114675074 14:24434845-24434867 CATGGCCTGCAGGAGGAGGTGGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118198678 14:63651822-63651844 CAGGGCCAAAAGGAGCAGCTTGG + Intergenic
1118878986 14:69810302-69810324 CAGGGACAGCAGGAGGAGCTGGG - Intergenic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119323875 14:73747097-73747119 GAGGGCCAGCTGGAGGAGGTAGG - Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119575273 14:75715295-75715317 CAGGGCCCACATGAGGAAGATGG - Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121053869 14:90837139-90837161 CAGGCCCCACAGGAGGAGTATGG - Intergenic
1121093968 14:91202865-91202887 CGGGGGCCACAGGAGGAGACTGG - Intronic
1121976230 14:98406427-98406449 CAGGGCCAACTGGAGAGGGCAGG + Intergenic
1122141198 14:99664101-99664123 CAAGGACAAAAGCAGGAGGCTGG - Intronic
1122286579 14:100655922-100655944 CAGGACCACCAGCAGGAGCCAGG - Intergenic
1122319595 14:100845732-100845754 CAGAGACAACACAAGGAGGCAGG - Intergenic
1122481279 14:102049078-102049100 TGGGGCAAACAGGAGGATGCTGG - Intronic
1122722558 14:103730434-103730456 CAGGCTCCCCAGGAGGAGGCAGG - Intronic
1202931018 14_KI270725v1_random:31756-31778 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1123421412 15:20139922-20139944 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1123490462 15:20775888-20775910 CAGGGCCACCGGGAGGCGGCCGG + Intergenic
1123530638 15:21146462-21146484 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1123546963 15:21344975-21344997 CAGGGCCACCGGGAGGCGGCCGG + Intergenic
1123632937 15:22274626-22274648 CAGGGCCCTGAGGAAGAGGCAGG - Intergenic
1124156771 15:27233027-27233049 CAGGGACAAGAGGAGGTGCCTGG - Intronic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1127296664 15:57614655-57614677 CAGGGCCATTTGGAAGAGGCAGG - Intronic
1127397207 15:58552446-58552468 GAGGGCAGAGAGGAGGAGGCGGG - Intronic
1127959259 15:63878915-63878937 CTGGGTCAAGCGGAGGAGGCAGG + Intergenic
1128557979 15:68644706-68644728 CAGGGCCCACAGCAGGAGTGGGG - Intronic
1128730956 15:70020808-70020830 AAGAGCCTGCAGGAGGAGGCTGG - Intergenic
1128735454 15:70051287-70051309 CAGGAAGAACAGGAGGAGCCTGG - Intronic
1128775350 15:70316140-70316162 CATGGGCACCAGGAGGAGACAGG + Intergenic
1128965248 15:72051831-72051853 CATGAACAGCAGGAGGAGGCAGG + Intronic
1129097588 15:73225410-73225432 AAGGACCATCAGGAGGGGGCGGG + Intronic
1129665528 15:77577494-77577516 CATGGCCTAGAGGGGGAGGCCGG - Intergenic
1130385321 15:83406471-83406493 CGTGGCCAACAGGAAGAGGAAGG - Intergenic
1131080583 15:89531226-89531248 GGGGGCCATCAGGAGGAGCCAGG - Intergenic
1131265234 15:90911627-90911649 CAGGGCCACAAGCAGGAGGGTGG - Intronic
1131285119 15:91050595-91050617 CAGTTCCAACAGGCGGAGACTGG + Intergenic
1131430076 15:92380253-92380275 CAGACCCACCAGAAGGAGGCTGG - Intergenic
1131467550 15:92667828-92667850 CAGGGCCAACGTGTGGGGGCTGG - Intronic
1132240623 15:100254832-100254854 CAGGGCCAGCCGGGGGAGGCGGG + Intronic
1202955294 15_KI270727v1_random:72191-72213 CAGGGCCACCGGGAGGCGGCCGG + Intergenic
1132551617 16:556049-556071 CAGCGCCAACAAGAGGGGCCAGG - Intergenic
1132556902 16:576516-576538 CTGGGCCCACAGGGAGAGGCGGG - Intronic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132717844 16:1301063-1301085 CAGGGCCAGCAGGGGGCGGCAGG + Intergenic
1132739236 16:1403115-1403137 CAGAGCCCACAGCAGCAGGCAGG + Intronic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132959080 16:2612309-2612331 CAGGGCCAAGCCCAGGAGGCAGG + Intergenic
1132972140 16:2694284-2694306 CAGGGCCAAGCCCAGGAGGCAGG + Intronic
1133062300 16:3182941-3182963 CAGGGCTGAGAGGCGGAGGCGGG - Intergenic
1133287192 16:4696051-4696073 CAGGGCCACCAGGATCAGGAAGG - Intergenic
1135148677 16:19986246-19986268 AAGGGCCAACAGCTGGAGCCTGG - Intergenic
1135398252 16:22147476-22147498 CTGGGGCATCAGGAGGAGGGAGG + Intronic
1136057544 16:27701629-27701651 CCGGGGCAGCAGGAGGAGCCAGG + Exonic
1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG + Exonic
1136513115 16:30751317-30751339 CAGGGCCAGCAGGAGGTGGGGGG - Intronic
1136537309 16:30907598-30907620 CAGGGTCAGCAGGCAGAGGCGGG + Intergenic
1136748737 16:32614610-32614632 CAGGCCCTACAGGACGAGGAGGG + Intergenic
1139924400 16:70478260-70478282 CTGGGCTCACAGGAGGTGGCTGG + Exonic
1140270889 16:73465455-73465477 CAGAGGCACCAGGAGGAGACGGG - Intergenic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141669037 16:85481943-85481965 CAGGGCCTTGAGGAGCAGGCCGG - Intergenic
1141750941 16:85957448-85957470 CAGGGGCATCAGGAGAATGCAGG - Intergenic
1142108380 16:88318333-88318355 CAGCGTCTCCAGGAGGAGGCTGG - Intergenic
1142132229 16:88436337-88436359 CAGGGCCCACAGGCTGAGGCCGG - Exonic
1203050871 16_KI270728v1_random:873824-873846 CAGGCCCTACAGGACGAGGAGGG + Intergenic
1142558897 17:798366-798388 CAGGCCCTGCAGGTGGAGGCTGG - Intergenic
1142581988 17:948880-948902 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142581996 17:948899-948921 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582004 17:948918-948940 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142582012 17:948937-948959 CAGGGGGGAGAGGAGGAGGCAGG - Intronic
1142676820 17:1518574-1518596 CTGGGGCAACAGGTGGAGGTGGG + Exonic
1142795702 17:2304946-2304968 GAGGGGCAACAGGTGGAGGCAGG - Intronic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143457606 17:7078046-7078068 CAGGGACAGCAGGAGATGGCAGG + Exonic
1143619503 17:8072997-8073019 CAGGGCCACCGGCAGGAGGAGGG - Intronic
1144202228 17:12952021-12952043 CGGGGGCCACAGGAGGAGCCAGG + Intronic
1144586691 17:16491770-16491792 CAGGGCCGGCGGGAGGAGGCGGG - Exonic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1144810794 17:17997662-17997684 GAGGGCCTACAGCAGGAGACAGG - Intronic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145798608 17:27669772-27669794 CAGGGCCAAGAGGAGGAAGCAGG + Intergenic
1146268333 17:31467927-31467949 AAGGGCAAACAGGAGCTGGCAGG - Intronic
1146447864 17:32947138-32947160 GAGAACCAATAGGAGGAGGCTGG + Intergenic
1146789997 17:35745743-35745765 CTGGGCCTACAGGAGCAGGAGGG - Exonic
1146797955 17:35795794-35795816 CCGGGTCAACTGGAGGTGGCGGG - Intronic
1147122368 17:38343298-38343320 CAGGGCCAGCTGTAGGTGGCTGG + Exonic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1147462429 17:40581937-40581959 CAGGGGCAAGAGGTGGGGGCAGG - Intergenic
1147677616 17:42218893-42218915 CAAGGCCAACAGGAGGACAATGG + Intronic
1147688423 17:42300678-42300700 CAAGGCCAACAGGAGGACAATGG - Intronic
1147743238 17:42680384-42680406 CAGGGCCAGCTGGAGCAGGTGGG + Exonic
1148166087 17:45484981-45485003 CAGGTCCCTCAGGAGGAAGCAGG + Intronic
1148392073 17:47279937-47279959 CAGGGACAACAGGAGGAGTCTGG + Intronic
1148497870 17:48064848-48064870 CAGTGCCTACAGGATGAGGTAGG - Intergenic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148845061 17:50525043-50525065 CAGGGCACACATGAGGGGGCAGG - Intronic
1149655648 17:58308484-58308506 CAGGGCCACCAGGTGGCAGCAGG + Intronic
1149687203 17:58542898-58542920 AAGGGCCACCATGAGGAGTCAGG + Exonic
1149992307 17:61389979-61390001 CAGGGCCACCAGGATGGGGAAGG - Intronic
1150241202 17:63634385-63634407 AAGGCCCAAAAGGACGAGGCTGG + Intronic
1150285157 17:63950116-63950138 CTGGCCCAGCAGGAGGAGGTGGG - Intronic
1150397310 17:64831705-64831727 CAGGTCCCTCAGGAGGAAGCAGG + Intergenic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1152068942 17:78125757-78125779 CAGGTCGTACAGGCGGAGGCTGG + Exonic
1152238347 17:79149856-79149878 CAGGCCCCAGAGGAGGAGGCTGG - Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152647534 17:81476436-81476458 GAGGGCCCACAGCAAGAGGCAGG - Intergenic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1152907754 17:82978193-82978215 AAGGGACCCCAGGAGGAGGCAGG - Intronic
1154448075 18:14450657-14450679 CAGGGCCACCGGGAGGCGGCCGG + Intergenic
1155086887 18:22467603-22467625 CAGGAGCAGCAGGAGGGGGCTGG + Intergenic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156461090 18:37321694-37321716 GAGGGGCAAGAGGAGGAGGCGGG + Intronic
1157281141 18:46347095-46347117 GAGGGCCTCCCGGAGGAGGCAGG + Intronic
1157439131 18:47696878-47696900 CAGGGCAAAGAGGAGGGGGTGGG - Intergenic
1157600490 18:48890209-48890231 CAGGGCAGAGAGGGGGAGGCCGG - Intergenic
1158622178 18:59042403-59042425 CAGTGCTAAGAGGAGGAAGCAGG - Intergenic
1158882772 18:61796884-61796906 CAGGGCCATTAGGAGGAGATTGG + Intergenic
1159796092 18:72846153-72846175 CAGAGCCAAGAGGAGCAAGCAGG + Intronic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160303165 18:77704802-77704824 CAGGGCCACGGGGAGGAGGACGG + Intergenic
1160527965 18:79548281-79548303 CAGGGCCAGCAGGTGGAAGGCGG - Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160873754 19:1288003-1288025 CCGGAGCAACAGGAGGTGGCTGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160986523 19:1841544-1841566 AACGCCCAGCAGGAGGAGGCCGG + Intronic
1161644686 19:5445804-5445826 CAGAGGCCACTGGAGGAGGCTGG - Intergenic
1162672142 19:12266298-12266320 GAGAGCCATCAGGAGGATGCTGG - Intronic
1163382489 19:16978205-16978227 CATGGGCAACAGGAGGAAGTGGG + Intronic
1164564303 19:29314921-29314943 CAGGGTGGAGAGGAGGAGGCTGG + Intergenic
1164794605 19:31015649-31015671 CAGGGCCAACAGGACCAGAAAGG + Intergenic
1164906616 19:31973465-31973487 CAGAGCCATCTGGAGGATGCTGG + Intergenic
1165313104 19:35040276-35040298 CAGGTCCAGCCGGAGGAAGCGGG - Intronic
1165900548 19:39167438-39167460 CAGGGCCACCAGGGGTGGGCTGG + Intronic
1165992764 19:39825777-39825799 CAGGGTCATCAGGAGGCGGGAGG + Exonic
1166560474 19:43729436-43729458 CTGGGCCAGCAGGAGGTGGTAGG + Exonic
1167570107 19:50281609-50281631 CGGCGCCAGGAGGAGGAGGCAGG + Exonic
1167591485 19:50406775-50406797 CAGGGCCAGAGGGAGGAGGAGGG - Intronic
1167688009 19:50968665-50968687 CAGAGCCAAGCGGAGGACGCAGG + Exonic
1167896354 19:52585391-52585413 CAGGGCCGGCACGAGGAGGGAGG - Exonic
1168465919 19:56601034-56601056 CAGGGCCATTGGGAGAAGGCAGG + Intronic
1202691062 1_KI270712v1_random:96077-96099 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
924988165 2:289036-289058 CAGGGGGAAGAGGAGGAGACGGG - Intergenic
925180020 2:1811526-1811548 CAGGGCAAGCAGGAGAAGCCAGG - Intronic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925650157 2:6081022-6081044 CATTGACAACAGTAGGAGGCAGG - Intergenic
926008885 2:9393151-9393173 AAGACCCAACAGCAGGAGGCCGG - Intronic
926033387 2:9613030-9613052 TAGAGCCAACAGGATGAGGGAGG + Intronic
927515088 2:23667658-23667680 CAGGGCCAGGAGGAGCAGCCGGG - Intronic
929720011 2:44358631-44358653 CAGGGACAACAGGTGTAGGCTGG + Intronic
930860837 2:56071206-56071228 CAGGGCCAACAGGTGGCTGCTGG + Intergenic
930994189 2:57696764-57696786 CCTGGCCATCAGGAGGAGGTAGG - Intergenic
931052347 2:58428586-58428608 CGGGGGCAAGAGGAGGGGGCTGG - Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931874634 2:66498525-66498547 CAGTGCTAACAGGAGGAGCTGGG + Intronic
932432790 2:71685700-71685722 CAGGGCCAGCGTGGGGAGGCAGG + Intronic
932702769 2:74002599-74002621 CAGGTCCACCAGGCGGGGGCAGG + Intronic
932818202 2:74878517-74878539 CAGGGGCAGGAGGAGGAGGAAGG - Intronic
933174394 2:79159264-79159286 CAGAGCTAACAAGAGGAGGAAGG - Intronic
933699346 2:85243606-85243628 CTGGGCCAGGAGGAGAAGGCTGG + Intronic
933955331 2:87357874-87357896 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
934239519 2:90254087-90254109 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
934273676 2:91562656-91562678 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
934461963 2:94217441-94217463 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935604013 2:104951626-104951648 CAGGGCTAAGGGGAGGAGGCGGG - Intergenic
937288861 2:120769972-120769994 CAGGGCCAAAATGAGGGGACAGG - Intronic
937376010 2:121336071-121336093 CCGGGTCCACAGTAGGAGGCAGG + Intergenic
937953746 2:127407999-127408021 CAGGGGGAAGAGGAGGGGGCGGG - Intergenic
938137397 2:128770464-128770486 CAGGGCCAGCAGGAAGAGCGTGG + Intergenic
938139916 2:128787062-128787084 CCCAGCCAACAGCAGGAGGCAGG - Intergenic
938582952 2:132663782-132663804 CAGGGACAAATGGAGGACGCTGG + Intronic
939960589 2:148561795-148561817 AAGGGGCAATACGAGGAGGCTGG - Intergenic
940255531 2:151724301-151724323 CAGGGGCATCAGGAGGAAGCAGG + Exonic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
942675882 2:178426629-178426651 CAGAGACAAAGGGAGGAGGCAGG - Intergenic
944594082 2:201245697-201245719 CAGGGTCAACAGGAGCTGCCTGG - Intronic
944932050 2:204529859-204529881 CAGGGGCAACAAGCAGAGGCTGG - Intergenic
945468237 2:210196419-210196441 CATGGCCAGTAGGAGGAGGTAGG - Intronic
945983770 2:216338547-216338569 GAGGGACAAAAGGAGGAGGTAGG - Intronic
946050178 2:216855798-216855820 AAGGGTCATCCGGAGGAGGCTGG + Intergenic
946183740 2:217965046-217965068 CAGGGCCAGCAGGTGGCTGCAGG + Intronic
946245093 2:218382907-218382929 CTGGGCCACCAGAAAGAGGCAGG + Intronic
947943035 2:234075586-234075608 CAGGGGCAGCAGGAAGAAGCCGG - Intronic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
948352188 2:237350171-237350193 CAGGACCAAAAGGAGGAATCGGG - Exonic
948384999 2:237575706-237575728 CAGGCCCTGCAGGAGGAGGAAGG - Intronic
948513320 2:238487691-238487713 CAGGGCCTCCGGGAGGAAGCAGG + Intergenic
948855981 2:240730853-240730875 CCCAGCCAACTGGAGGAGGCTGG + Intronic
948907853 2:240988335-240988357 GAGTGCCAACAGCAGAAGGCAGG + Intronic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1169758644 20:9068495-9068517 CAGCGCCAAGAGGAGGTGGGTGG - Intergenic
1170757321 20:19215573-19215595 AAGGGCCAACAGAAGGAAGGAGG - Intronic
1171179832 20:23084396-23084418 CAGGGCCAGCAGGAGTAGGATGG + Exonic
1171242353 20:23581977-23581999 AAGGGCCATCAGGTGGGGGCGGG + Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1172033304 20:31996071-31996093 GTGGGCCACCAGGAGGAGGCCGG - Intronic
1172314537 20:33943556-33943578 CAGGGCTAGTAGGTGGAGGCTGG - Intergenic
1172556826 20:35849437-35849459 TAGAGCTACCAGGAGGAGGCAGG + Intronic
1172839644 20:37894610-37894632 CAGAGCCCTCAGGTGGAGGCAGG - Intergenic
1172980148 20:38935382-38935404 CAGGGCCACCAGAGGGTGGCAGG - Intronic
1173063073 20:39680650-39680672 CAAGGCCATAAGGAGGAAGCTGG - Intergenic
1173082115 20:39878067-39878089 CAGGGCAGACAGGAGTAGCCAGG + Intergenic
1173314093 20:41927963-41927985 CAGTGCAAACATGTGGAGGCAGG - Intergenic
1174832220 20:53823394-53823416 AAGGGCCATGGGGAGGAGGCTGG + Intergenic
1175220591 20:57414386-57414408 CAGGGCCAACAAGGGGCAGCAGG + Intergenic
1175531148 20:59674844-59674866 AAGGGGCAACAGGAGAAGGCAGG - Intronic
1175918156 20:62437187-62437209 CAGGGCCAACAGGACAGGCCTGG - Intergenic
1175952393 20:62590498-62590520 CAGGCCCTGCCGGAGGAGGCTGG - Intergenic
1175968782 20:62673463-62673485 CAGTGACACCCGGAGGAGGCAGG - Intronic
1176025196 20:62982109-62982131 GAGGGGCAACAGGAGGCAGCAGG + Intergenic
1176057013 20:63154396-63154418 CAGGGCCACCAAGAACAGGCAGG + Intergenic
1176062124 20:63177007-63177029 CAGGGCCATCCGCAGGAGGCCGG + Intergenic
1176071095 20:63226788-63226810 TGGGGCCCACAGGTGGAGGCAGG + Intergenic
1176139115 20:63537454-63537476 CTGGGCCCTCAGGAGGAGCCGGG - Intergenic
1176448158 21:6840036-6840058 CAGGGCCACCGGGAGGCGGTCGG - Intergenic
1176593041 21:8660378-8660400 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1176826328 21:13705058-13705080 CAGGGCCACCGGGAGGCGGTCGG - Intergenic
1178959041 21:37047395-37047417 AAGGGCCATCAGGTGGGGGCAGG - Intergenic
1179564766 21:42240321-42240343 AAGAGCAAACAGGAGGAGCCAGG - Intronic
1179574729 21:42301049-42301071 CATGGCCAACATCACGAGGCAGG - Intergenic
1179896054 21:44364361-44364383 CTGGGGCAAGAGCAGGAGGCTGG + Intronic
1179913288 21:44461224-44461246 CAGGCCCCACAGGAGCTGGCTGG + Exonic
1179937077 21:44612791-44612813 CTGGGCTGGCAGGAGGAGGCAGG - Exonic
1179955311 21:44735049-44735071 GGGTGCCAACAGGAGGGGGCAGG + Intergenic
1180082685 21:45493932-45493954 CAGGGCCCCCAGGAAGAGGCTGG - Intronic
1180275888 22:10637505-10637527 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1180331684 22:11486866-11486888 TAGGTACAAAAGGAGGAGGCAGG - Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1181185237 22:21098623-21098645 GAGGGCCACCAGGAAGATGCTGG + Intergenic
1181354287 22:22289328-22289350 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1182681857 22:32085737-32085759 CAGGGCCAGCAGGGCGGGGCAGG + Intronic
1183018095 22:35006438-35006460 CAGGGCTAAAAGCAGGAGCCAGG + Intergenic
1183086294 22:35489317-35489339 CAAGGCCAGCTGGAGGAGCCTGG + Intergenic
1183714745 22:39527089-39527111 CAGGGCCGACAGGACAAAGCAGG - Intergenic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184131466 22:42519300-42519322 CAGGGGCAAGAGGAGAAGGAGGG + Intronic
1184141692 22:42581516-42581538 CAGGGGCAAGAGGAGAAGGAGGG + Intergenic
1184407248 22:44307142-44307164 CAAGGCCCACAGGAGGATGGAGG - Intronic
1184649109 22:45911589-45911611 CACCCCCAACAGGAGGACGCCGG + Intergenic
1185063686 22:48620288-48620310 CAGGGCCCTGAGGAAGAGGCGGG - Intronic
1185077365 22:48690549-48690571 AAGGGCCTGCAGGAGGATGCAGG - Intronic
1185115340 22:48931586-48931608 CAGGGCCATTTGGAGGTGGCTGG + Intergenic
1185116468 22:48941040-48941062 CAGGGCTCACAGTAGGAGCCAGG + Intergenic
950172821 3:10851273-10851295 AAGTGGCAATAGGAGGAGGCGGG - Intronic
950468783 3:13172031-13172053 CAGGCCCCACAGGAGCAGGTGGG + Intergenic
950533895 3:13568620-13568642 CAGGGCCAAGGGGCTGAGGCCGG - Intronic
950689868 3:14647077-14647099 CAGGGCCAACAAGAAGGGTCGGG + Intergenic
950868989 3:16212801-16212823 CAGGGCCACTAGCAGGAGGTGGG + Intronic
951424066 3:22521308-22521330 CAGGGCCAGCTGGGGGAGGGGGG + Intergenic
951536968 3:23749169-23749191 CAGGGACAACAGGGGTATGCAGG - Intergenic
953787856 3:45924118-45924140 CAGGACCAACAGGAGACAGCTGG - Intronic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
953920139 3:46946100-46946122 CCAGGCCTACAGGAGGAGGGAGG + Intronic
954413469 3:50381360-50381382 CAGGTCCCACATGAGCAGGCAGG + Intronic
954808969 3:53236299-53236321 CAGGGGCAGCAGGAAGAGGCTGG + Intronic
954930089 3:54273633-54273655 CACGGACAGCAGGAGCAGGCTGG + Intronic
960221385 3:115113456-115113478 CAGTGCCAAAAGCAGGAGGCAGG - Intronic
960284370 3:115810718-115810740 CAGGGCCAACAGGAGGAGGCTGG - Intronic
960602145 3:119469085-119469107 CAGGGCCGCCAGAAGGAGTCAGG + Exonic
960874529 3:122283906-122283928 CAGGGAGAAGAGGAGGAGGTAGG - Exonic
961016172 3:123469972-123469994 CAGGGCCCACAGGGGCAGGGAGG + Intergenic
961147091 3:124603328-124603350 CAAGGCTACCAGGAGGAGGCAGG - Intronic
961349114 3:126287748-126287770 CAGAGCTCACAGGAGGGGGCTGG - Intergenic
961357032 3:126345800-126345822 GAGGGCCTGCAGGAGGAGACAGG + Intronic
961552561 3:127677567-127677589 CAGGGGCAACAGGAGGGCACAGG - Intronic
962118601 3:132538231-132538253 CATGGTCTACAGGAGGTGGCAGG - Exonic
962171516 3:133106129-133106151 CAGAGCCTATAAGAGGAGGCTGG + Intronic
962770286 3:138604922-138604944 CAGGGCCAAGATGGGGAGCCAGG - Intergenic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
965736896 3:171830112-171830134 CAGGGCCACCTGGAGGCAGCTGG + Intergenic
967787910 3:193517405-193517427 CTGGGACAACAGGAGTAGGTGGG + Intronic
967828150 3:193895361-193895383 GAGGGCCAGCAGGAGAGGGCAGG - Intergenic
968520856 4:1034142-1034164 CAGGTCCAACAGCGGGCGGCGGG + Intergenic
968576632 4:1369262-1369284 GAGGGCCCAAAGGAGGGGGCAGG + Intronic
968621347 4:1604729-1604751 CTGGGGAAGCAGGAGGAGGCGGG - Intergenic
970017189 4:11525314-11525336 CAGGGCAAAGAGGACAAGGCTGG - Intergenic
970427986 4:15963094-15963116 CAAGGTCACCAGCAGGAGGCAGG + Exonic
970432048 4:15997929-15997951 CAGAGCCTCCAGGAGGGGGCCGG + Intronic
970641923 4:18076338-18076360 TAGGGCTGACAGGAAGAGGCTGG - Intergenic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
973980615 4:56305545-56305567 CAAGTCCAACAGGAAGTGGCAGG - Intronic
974057188 4:56996002-56996024 CAAGGGCAATAGTAGGAGGCAGG + Intronic
977852633 4:101848360-101848382 CATGGCGGACAGGAGGAGGCAGG - Intronic
977979238 4:103303379-103303401 CAGGGCTAGCAGGAGCAAGCAGG + Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
979573545 4:122258744-122258766 CAGAGCTACCAGGTGGAGGCCGG - Exonic
979882948 4:125986012-125986034 CAAGGGCAAGAGGAGGAGGGTGG - Intergenic
981096545 4:140788157-140788179 CAGGACCCACTTGAGGAGGCAGG + Intergenic
982260258 4:153488437-153488459 CAGGGCCCAGAGGAGGCAGCCGG + Intronic
982984293 4:162185711-162185733 GAGGTCCTACTGGAGGAGGCTGG - Intergenic
983035892 4:162865191-162865213 TAAGGCCATCAGGTGGAGGCAGG - Intergenic
985345558 4:189001334-189001356 CTGTGCCAACAGGAAAAGGCTGG + Intergenic
985348060 4:189027938-189027960 CAGGGCTAGCAGGTGGAGGGTGG - Intergenic
985674582 5:1224470-1224492 CAGACCCCCCAGGAGGAGGCAGG - Exonic
985675756 5:1230512-1230534 CAGGGCCAGCATGTGGGGGCCGG - Intronic
985680878 5:1254973-1254995 CAGGGCAAACAGGAGAGGCCAGG + Intronic
985747457 5:1655246-1655268 CAGGGCCAAAATGTGGACGCAGG + Intergenic
986039085 5:3969476-3969498 CAGGGGAGACAGTAGGAGGCAGG + Intergenic
986729364 5:10623806-10623828 CTGGGTGGACAGGAGGAGGCGGG + Intronic
986858820 5:11903744-11903766 CAGCGGCAAGAGGAGGAGGACGG + Intronic
987033208 5:13994736-13994758 CAGAGCCAAGGGGAAGAGGCGGG - Intergenic
988874037 5:35424267-35424289 CAGGGCCAAAAGAAAGAGGAAGG - Intergenic
990007860 5:50964073-50964095 AAGGCCCCACAGGAGGAGGAGGG + Intergenic
991163476 5:63533044-63533066 CAGGGAAAACTAGAGGAGGCTGG - Intergenic
991636828 5:68714722-68714744 CATGACCAACAGGAGGAAGGAGG - Intergenic
991923889 5:71684459-71684481 AAGGGCCACCAGGTGTAGGCAGG - Intergenic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
995799531 5:115979063-115979085 TAGAGCCACCTGGAGGAGGCTGG - Intronic
996124134 5:119706047-119706069 AAGGACCATCAGGTGGAGGCAGG + Intergenic
996184925 5:120464047-120464069 CAGAACCAAGAGGAGGGGGCGGG + Intergenic
996330022 5:122318109-122318131 CTGCACCCACAGGAGGAGGCAGG - Intronic
996574046 5:124962940-124962962 CAGGTTCCACAGGAAGAGGCAGG - Intergenic
997385245 5:133467371-133467393 CTGGGCCTGCAGGAGGAGGCTGG + Intronic
997606232 5:135177443-135177465 CAGGCCCTACTGGAGGAGGAAGG - Intronic
997751851 5:136354462-136354484 CCAGGCCAACAGGAGGTTGCAGG - Intronic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999623105 5:153491725-153491747 GAGAGCCAACAGGAGGAGAAAGG - Intronic
1000027524 5:157372832-157372854 CACGGCCAATGGGAGGAGGGTGG - Intronic
1001334032 5:170783143-170783165 GAGGCCCAGGAGGAGGAGGCGGG - Intronic
1001433805 5:171683904-171683926 TAGGGCAAACAGGAGGAGGTGGG - Intergenic
1001435072 5:171693738-171693760 CAGGTCCCCCAGCAGGAGGCTGG - Intergenic
1001594287 5:172887894-172887916 GAGTGGAAACAGGAGGAGGCAGG + Intronic
1001990613 5:176112986-176113008 CAGGCCCTACAGGAGGAGAAGGG + Intronic
1002167597 5:177358089-177358111 CAGGGCCACGAGGAGGGGGTGGG + Intronic
1002226260 5:177725154-177725176 CAGGCCCTACAGGAGGAGAAGGG - Intronic
1002267591 5:178046059-178046081 CAGGCCCTACAGGAGGAGAAGGG + Intronic
1002420964 5:179148891-179148913 CTGGGCCAACAGGAACTGGCTGG + Intronic
1003094794 6:3133613-3133635 AAGGGCCCACACAAGGAGGCAGG - Intronic
1003340985 6:5220620-5220642 CAGGGCCCAGAGGAGGGTGCTGG + Intronic
1003590855 6:7435490-7435512 CAGAGACAAAGGGAGGAGGCAGG + Intergenic
1005083570 6:21981238-21981260 CAGTGCCAGAAGGAAGAGGCAGG - Intergenic
1005917346 6:30364796-30364818 CAGGGAGACCAGGAGGTGGCAGG + Intergenic
1005979779 6:30828121-30828143 CTGGGTCAACAGATGGAGGCAGG + Intergenic
1006410913 6:33872744-33872766 CAAGGCCCACAGGTGGGGGCTGG + Intergenic
1006634566 6:35452622-35452644 CAGCGCCTGCAGCAGGAGGCGGG - Exonic
1006888250 6:37400181-37400203 CAGAACCAACAGGAGAAGGAAGG - Intergenic
1009318375 6:62253484-62253506 AAGGCCAAAGAGGAGGAGGCAGG - Intronic
1009945065 6:70333737-70333759 CAATGCCAACAGGAGAAAGCAGG - Intergenic
1012233599 6:96787717-96787739 CAGAGGCAACAGGATGAGTCAGG + Intergenic
1012471710 6:99579877-99579899 CAGGAGCAAGAGGTGGAGGCTGG - Intergenic
1013481342 6:110555418-110555440 CTGGGACAGAAGGAGGAGGCGGG + Intergenic
1014802320 6:125790896-125790918 GAGGAGCAAGAGGAGGAGGCGGG - Exonic
1017018373 6:150119431-150119453 GAGGGACCACAGGAGGAAGCTGG + Intergenic
1017198809 6:151730337-151730359 CCAGTCCAACAGGTGGAGGCAGG - Intronic
1017718772 6:157230485-157230507 CAGGGCCATCAGGAGAAGCAGGG + Intergenic
1017726774 6:157281753-157281775 GACGGCCAGCAGGAGGCGGCTGG - Intergenic
1018205841 6:161436311-161436333 GAGGGCAGAGAGGAGGAGGCGGG + Intronic
1019317504 7:395365-395387 CAAGGACAACATGAGGAGCCTGG - Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019355535 7:576909-576931 CAGGCCGAAAAGCAGGAGGCTGG - Intronic
1019427161 7:983198-983220 CAGGGCCATGAGGACGTGGCTGG - Exonic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1019519804 7:1455475-1455497 CACGCCCACCAGGAGGTGGCAGG - Intronic
1022530086 7:31061542-31061564 CCTGACCCACAGGAGGAGGCTGG + Intronic
1023004248 7:35846276-35846298 CAGGTCCAACAATGGGAGGCAGG - Intronic
1023382590 7:39623585-39623607 CAGAGCCGCCAGGAGGAGGGTGG + Exonic
1024253237 7:47521792-47521814 AAGGGCCACCATGAGGATGCAGG + Intronic
1026379010 7:69780526-69780548 TAGGGCAAAGAGGAGGAGGGCGG + Intronic
1026617343 7:71917228-71917250 CAGAAACAACAGGATGAGGCAGG + Intronic
1026878473 7:73893523-73893545 CAGCCCCCGCAGGAGGAGGCTGG + Intergenic
1026894059 7:73999964-73999986 CAAGGTCAACAGCACGAGGCGGG + Intergenic
1026941360 7:74289665-74289687 CGGGCCCGAGAGGAGGAGGCCGG + Exonic
1027270039 7:76514031-76514053 GAAGGCCAAGAGTAGGAGGCCGG - Exonic
1028477581 7:91267384-91267406 AGGGGGCAAAAGGAGGAGGCGGG - Exonic
1031982254 7:128135674-128135696 CCGGGCCAAAAGGAGGATGGAGG + Intergenic
1032267529 7:130379798-130379820 TAAGGCCAGCAGGAGGGGGCTGG + Intergenic
1032445206 7:131976420-131976442 CAAAGCCAACTGGGGGAGGCTGG + Intergenic
1032548442 7:132762597-132762619 CAGGGGCGCCAGGAGGAAGCAGG + Intergenic
1034420361 7:150987404-150987426 CAGGGCCCAGATGAGGAGGCTGG + Intergenic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034572249 7:151965580-151965602 CAGCGTTAACAGTAGGAGGCTGG + Intronic
1034781432 7:153886316-153886338 CAGGGGCAGCAGGTGGAGACGGG + Intergenic
1034875638 7:154722615-154722637 CAGGGGCGGCAGCAGGAGGCAGG + Intronic
1035068391 7:156123997-156124019 CAGGACACACAGGCGGAGGCAGG + Intergenic
1035406780 7:158604044-158604066 CTTAGCCACCAGGAGGAGGCTGG - Intergenic
1036229564 8:6988227-6988249 CAGGGCCACCAGGAGAAGCATGG + Intergenic
1036232015 8:7007330-7007352 CAGGGCCACCAGGAGAAGCATGG + Intronic
1036288271 8:7463453-7463475 CAGGGCCACAAGGAGAAGGCTGG + Exonic
1036333204 8:7848075-7848097 CAGGGCCACAAGGAGAAGGCTGG - Exonic
1037348388 8:17923446-17923468 CAGGGCCAGCAGGAGGGGCGAGG - Intronic
1037654343 8:20870279-20870301 CAGTGCCAGCATGAGGACGCAGG + Intergenic
1037669593 8:21002664-21002686 CTGGGCAAACAGGAAGAAGCTGG + Intergenic
1038035088 8:23680761-23680783 CAAGGCCAACAGGAGGCTTCTGG + Exonic
1038084944 8:24185684-24185706 CAGGTCCAAAAGAAGTAGGCTGG - Intergenic
1038661620 8:29502472-29502494 GAGGGACAACAGGAGGGGTCTGG - Intergenic
1040561035 8:48523744-48523766 CAGGGGCAACAGGAAAACGCAGG - Intergenic
1042304129 8:67313873-67313895 AAGGACCATCAGGTGGAGGCAGG + Intronic
1042454842 8:68989200-68989222 CAAGGCGAACAGGAAGAGGAAGG + Intergenic
1042624978 8:70748204-70748226 CAGAGCCAGCAGGAGCAGGTGGG + Intronic
1043704562 8:83331917-83331939 CAGGACCAGAAGGAGAAGGCAGG - Intergenic
1043816872 8:84812537-84812559 CAGGACCATCAGGTGGGGGCAGG + Intronic
1044728107 8:95209213-95209235 CTGGGCCAACAGGATGGGACAGG - Intergenic
1046885588 8:119363522-119363544 CAGAGACAAAATGAGGAGGCAGG - Intergenic
1048165459 8:132058257-132058279 CTTGGCCAACAGGAGGATACTGG - Intronic
1048444460 8:134482894-134482916 GAGGCCCAACAGGAGGCTGCAGG - Intronic
1049029352 8:140023010-140023032 CAGGGCCCACTGGAGGAGGAGGG + Intronic
1049181599 8:141225858-141225880 GAGGGCAAAGGGGAGGAGGCTGG - Intronic
1049436366 8:142587925-142587947 CAGGACCAAAAGGAGGAAACTGG + Intergenic
1049440302 8:142606539-142606561 GAGGAACAACAGGAGGGGGCAGG - Intergenic
1049512785 8:143038140-143038162 CAGGCCCAAAAGGAGGGGCCAGG - Intergenic
1049558182 8:143294084-143294106 GAGGGGCAGCAGGAGGAGGGGGG - Intronic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049630513 8:143652657-143652679 CAGTGGGGACAGGAGGAGGCAGG + Exonic
1049684151 8:143932601-143932623 CAGGGCCAGCCGGGGGAGGTGGG - Intronic
1049816626 8:144606039-144606061 GAGGGCGAACAGGAGGACACAGG + Intergenic
1049867162 8:144946630-144946652 CAGGCCCAACAGCAGGACACAGG - Intronic
1049867214 8:144946828-144946850 CAGGCCCAACAGCAGGATACAGG - Intronic
1049867258 8:144947011-144947033 CAGGCCCAACAGCAGGATACAGG - Intronic
1049867262 8:144947030-144947052 CAGGCCCAACAGCAGGACACAGG - Intronic
1050084644 9:1951769-1951791 CAGAGCCAACAAGAAGAGGGAGG + Intergenic
1051093410 9:13436985-13437007 CAGTGACTTCAGGAGGAGGCTGG - Intergenic
1052777035 9:32742606-32742628 CAGGACAATCAGCAGGAGGCAGG + Intergenic
1053377979 9:37624336-37624358 CAGGGCACACAGCAGGAGACAGG + Intronic
1053692442 9:40593119-40593141 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1053897142 9:42753694-42753716 CAGAGCCAGCAGGGGGTGGCAGG + Intergenic
1054272374 9:63044414-63044436 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1054303684 9:63394037-63394059 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1054402462 9:64720547-64720569 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1054436072 9:65204878-65204900 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1054494320 9:65816809-65816831 CAGGGCCAAAAGGAGGGGCCAGG + Intergenic
1055760219 9:79599089-79599111 CAGTGCCAAGAGGAGGATGGAGG + Intronic
1057187084 9:93062995-93063017 CAGTGCCAAGAGTAGGAGGCTGG - Intronic
1057209783 9:93193461-93193483 CCGAGCCAGCAGGTGGAGGCTGG + Intronic
1057290213 9:93801621-93801643 AAGGGCCAACAGGAGAGGCCAGG - Intergenic
1057307478 9:93920630-93920652 CAGGCCCACGAGGAGGAGGAGGG + Intergenic
1058146345 9:101416066-101416088 CAGGGCCCTCAGGGGGAGGGGGG - Intergenic
1058588512 9:106535688-106535710 CATGGGCAACAGCAGAAGGCAGG + Intergenic
1059320066 9:113462472-113462494 CATGGCCAACAGCAGGTGGAAGG - Intronic
1060485251 9:124042343-124042365 CAGGGCCAGGAGGGGGAGGCAGG - Intergenic
1060940798 9:127541913-127541935 CAAGCCCAACAGGGTGAGGCAGG + Intronic
1061034463 9:128105993-128106015 CAGGGACAGCAGGGCGAGGCAGG + Intronic
1062137547 9:134937733-134937755 CAGAGCTGACTGGAGGAGGCAGG - Intergenic
1062171748 9:135138587-135138609 CAGGGCCAAGAGGTGGTGTCTGG - Intergenic
1062178909 9:135180160-135180182 CAGTGACAACAGGAGGAGTGAGG + Intergenic
1062193984 9:135263261-135263283 CTGGGCCACCAGGAAGAAGCAGG + Intergenic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1203760835 EBV:12512-12534 CAGGGCCACCCGGCGGAGCCAGG - Intergenic
1203761764 EBV:15584-15606 CAGGGCCACCCGGCGGAGCCAGG - Intergenic
1203762693 EBV:18656-18678 CAGGGCCACCCGGCGGAGCCAGG - Intergenic
1203763622 EBV:21728-21750 CAGGGCCACCCGGCGGAGCCAGG - Intergenic
1203764551 EBV:24800-24822 CAGGGCCACCCGGCGGAGCCAGG - Intergenic
1203765480 EBV:27872-27894 CAGGGCCACCCGGCGGAGCCAGG - Intergenic
1203766409 EBV:30944-30966 CAGGGCCACCCGGCGGAGCCAGG - Intergenic
1203767338 EBV:34016-34038 CAGGGCCACCCGGCGGAGCCAGG - Intergenic
1203623085 Un_KI270749v1:139185-139207 CAGGGCCAAAAGGAGGGGCCAGG - Intergenic
1186476615 X:9862621-9862643 CAGGTCCCACTGGAGCAGGCAGG + Intronic
1188338771 X:28972948-28972970 CATGACCAACAGGATGAGGATGG - Intronic
1188532907 X:31162318-31162340 GAAGGCCAACAGGAGGATGAGGG + Intronic
1189052858 X:37664720-37664742 CAGGGCCTACTTGAGGAGGGAGG - Intronic
1189094924 X:38127968-38127990 GAGGGCCAAGATGAAGAGGCAGG + Exonic
1190303914 X:49071876-49071898 CTGGGACAAGAGCAGGAGGCTGG - Exonic
1190643555 X:52503811-52503833 CAGGCCCAACAGGGGTAGCCTGG + Intergenic
1192148098 X:68695033-68695055 CAGGTCGCACAGGAGGAGTCAGG - Intronic
1192363697 X:70454620-70454642 GAGGGCCCACAGGAGAAGACTGG + Intronic
1195418548 X:104647203-104647225 CTGGGACAGCTGGAGGAGGCAGG + Intronic
1195510348 X:105709171-105709193 CAGAGCCAACAGAAGCAGCCAGG + Intronic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1195803464 X:108736685-108736707 GAGGACCGAGAGGAGGAGGCGGG + Intergenic
1195940995 X:110168028-110168050 CTGAGCCAACAGGCGGTGGCAGG - Intronic
1196411865 X:115428117-115428139 CAGGGGCAACGGGAGTAGGAAGG + Intergenic
1196465503 X:115968549-115968571 CGGGGCGAACAGGAGGAGAAGGG - Intergenic
1196768356 X:119270113-119270135 CAGGGCCTACAGGATTAGGCAGG + Intergenic
1198083845 X:133264723-133264745 CAAGGCCAATAGGAGGAGAAGGG - Intergenic
1198312834 X:135437531-135437553 GAAGGCCAACAAGAGGAAGCTGG + Intergenic
1198497721 X:137209786-137209808 CAGGTCCAGAAGCAGGAGGCGGG + Intergenic
1199574623 X:149301505-149301527 GAGGGCAAACAGCAGAAGGCAGG + Intergenic
1199685655 X:150263053-150263075 CACGGCAACCAGGTGGAGGCAGG - Intergenic
1199974220 X:152883119-152883141 CAGGGTCAACAGGAGCAGCCAGG + Intergenic
1202092028 Y:21201619-21201641 AAGGGCCCACAGGAGAAGGCAGG - Intergenic