ID: 960285152

View in Genome Browser
Species Human (GRCh38)
Location 3:115819868-115819890
Sequence CTGCTCCTACAGAAGGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 4, 3: 8, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960285152_960285155 7 Left 960285152 3:115819868-115819890 CCCATCACCTTCTGTAGGAGCAG 0: 1
1: 0
2: 4
3: 8
4: 137
Right 960285155 3:115819898-115819920 TGAGCACATTTTTGAAAATGTGG 0: 1
1: 0
2: 2
3: 64
4: 564
960285152_960285156 28 Left 960285152 3:115819868-115819890 CCCATCACCTTCTGTAGGAGCAG 0: 1
1: 0
2: 4
3: 8
4: 137
Right 960285156 3:115819919-115819941 GGTTATGTGTTGCCATCTTGTGG 0: 1
1: 0
2: 2
3: 11
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960285152 Original CRISPR CTGCTCCTACAGAAGGTGAT GGG (reversed) Intronic
905149697 1:35917975-35917997 CAGCTCCTAGAGAAGGGGAAGGG + Intronic
906078832 1:43070330-43070352 TTGCCCTTCCAGAAGGTGATTGG - Intergenic
907714572 1:56915287-56915309 ATGCTCCTTCATAAGGTCATTGG - Intronic
908439662 1:64141303-64141325 CAGCTTCTGCAGAAGGTGAACGG + Intronic
915092175 1:153434299-153434321 CTGCTCCTACATAATGGGGTAGG + Intergenic
917891100 1:179439168-179439190 CTGGGCCCACAGAAGGGGATAGG + Intronic
918526094 1:185466747-185466769 CAGCTCCTACAGATGATCATTGG - Intergenic
920295729 1:204954927-204954949 CTGCTCATCCAGAAGATGACCGG - Exonic
924449824 1:244167790-244167812 CTGCTACTATAGAAAGCGATAGG + Intergenic
1068253958 10:54483594-54483616 CTTTACCAACAGAAGGTGATAGG + Intronic
1070153921 10:73821811-73821833 CTGCTCCTACAAGAGGTGCAAGG + Intronic
1071427292 10:85571669-85571691 CTGCTTTTACAGAAGCTGGTTGG - Intergenic
1073452840 10:103619747-103619769 CTGCTCCTGCAAAAGGTTCTTGG + Intronic
1073833428 10:107413139-107413161 CTGCTCACACAGCAGGTGTTTGG - Intergenic
1074388686 10:113038083-113038105 CTGCTCCCAGAGAAGGTATTTGG + Intronic
1074971329 10:118541855-118541877 ATCCTCCTACAGAAGCAGATAGG + Intergenic
1076699051 10:132260755-132260777 CTGCCCCTCCAGGTGGTGATGGG - Intronic
1077657825 11:4039035-4039057 CTACTCCTACACAAGCTGAAGGG - Intronic
1077781104 11:5330685-5330707 CTGATCCTTAAGAAGGTCATGGG - Intronic
1078363893 11:10691342-10691364 CTGCTCCTCCAGGAGGTGTGGGG + Intronic
1082757433 11:57091989-57092011 ATGCTCCTGTAGAAGGTGTTTGG + Intergenic
1085441767 11:76570679-76570701 CTGCTCCTTCAATAGGTGAATGG - Intergenic
1087767000 11:102165896-102165918 CTGCTTCTCCAGAAGGTGATGGG + Intronic
1088321504 11:108558735-108558757 ATGCTGCTGCTGAAGGTGATGGG + Intronic
1089536153 11:119161772-119161794 CTGCCCCCACCAAAGGTGATGGG - Exonic
1090746566 11:129710290-129710312 CAGATCCTCCAGCAGGTGATGGG - Intergenic
1091449918 12:565970-565992 CTGCTCCTGCAGGTGGTCATCGG - Exonic
1094135571 12:27121787-27121809 CTTGTGCTACAGTAGGTGATTGG + Intergenic
1094185062 12:27633199-27633221 CTTGTGCTACAGTAGGTGATTGG + Intronic
1096590154 12:52652733-52652755 CTCCTCTTACAGAAAGTAATTGG + Intergenic
1099035781 12:77585677-77585699 CTGATCCTACAGGAGGTGATCGG + Intergenic
1101739085 12:107486162-107486184 CTGCCCCTGCAGAAGGGCATTGG - Intronic
1103455294 12:121060480-121060502 CTGCTCCTGCAGCAGGAAATAGG - Intergenic
1104113051 12:125722080-125722102 CTGCTCCTGGACAAGCTGATGGG + Intergenic
1105579835 13:21684925-21684947 CTGTTCCTCCAGCAGGTGAGGGG + Intronic
1107068407 13:36242881-36242903 CTGCTGCTACATAAGGGGGTGGG + Intronic
1107388692 13:39941259-39941281 ATGCTCCTACAAAATGTAATAGG + Intergenic
1107559183 13:41545098-41545120 CTGCTGCGGCAGAAGGGGATGGG + Intergenic
1108723194 13:53152784-53152806 CAGCTACTCCAGAAGTTGATGGG - Intergenic
1112223682 13:97516190-97516212 GTGTTCCTATGGAAGGTGATTGG - Intergenic
1113019509 13:105868404-105868426 CTGAACCTAAAGAAGGTGATAGG - Intergenic
1114569086 14:23653403-23653425 CTGCTCCCAAGGCAGGTGATGGG - Intergenic
1116918597 14:50549069-50549091 CAGCTTCTACAGGAGGTGCTTGG + Intronic
1119023245 14:71132761-71132783 CAGCTTCTACAGTATGTGATAGG + Intergenic
1119977568 14:79042227-79042249 GTACTCCTACAGAAAATGATAGG - Intronic
1121693543 14:95894621-95894643 CAGCACCTGCAGAAGGTCATGGG - Intergenic
1121836572 14:97097794-97097816 CTGGTCCTCCAGGAGGTTATTGG - Intergenic
1122536372 14:102466301-102466323 TTCCTCCTCCAGAGGGTGATGGG + Intronic
1124827586 15:33114060-33114082 CTGCTCCAAGAGAAGGTGTTGGG - Intronic
1125267631 15:37901452-37901474 ATGCTCCCTCTGAAGGTGATAGG + Intergenic
1133951137 16:10393477-10393499 ATGATGCTACAGAAAGTGATAGG + Intronic
1136117133 16:28101599-28101621 CTCCTCCTGCAGAAGATCATGGG + Exonic
1136223252 16:28842483-28842505 CTGTTCCCACAGAATGTGAATGG + Exonic
1137758962 16:50925219-50925241 CAGCTCCTTGAGAAGGTGGTGGG - Intergenic
1138566624 16:57838096-57838118 TTGCTCCTTCAGAAGATGAAAGG - Intronic
1139268631 16:65662145-65662167 CTGGTCCTACTGCAGATGATTGG - Intergenic
1143501913 17:7344109-7344131 CTGCTGAAACAGAAGGTGAGGGG + Exonic
1146571141 17:33954319-33954341 CTGCTCCCACACATGCTGATGGG - Intronic
1150549671 17:66197702-66197724 CTGGTAGTACAGAAGGTGGTGGG + Intergenic
1151063697 17:71126321-71126343 CTGCTCCTACAGAAAGAGAATGG - Intergenic
1151304451 17:73254035-73254057 CTGCTTCTACAGAGAGTGCTGGG - Intronic
1152735730 17:81995977-81995999 CTGCTCCTCCTGCAGGTGACGGG + Exonic
1154268967 18:12902733-12902755 CTGCTCCATCACCAGGTGATAGG - Intronic
1159868824 18:73737554-73737576 CTTCTCCTTCAGTAGGTGAATGG - Intergenic
1160541736 18:79627642-79627664 CTGCTCCTGGAGAACGTGGTTGG + Intergenic
1161583670 19:5093862-5093884 CTGCTCCTAGAGAGGGTGCAGGG + Intronic
1161989711 19:7677753-7677775 CTGCCCCTTCCCAAGGTGATGGG - Intronic
1166154203 19:40898513-40898535 CTGCTCATCCAGAAAGTGCTGGG - Intergenic
1166173901 19:41052067-41052089 CTGCTCATCCAGAAAGTGCTGGG + Intergenic
930722635 2:54652657-54652679 CAGCTCCTACAGAAGGTAAATGG - Intronic
933805912 2:85997926-85997948 CTCCTTCTACAGAGGGTGATAGG - Intergenic
935160085 2:100522566-100522588 CTGGTACTACACAAAGTGATTGG + Intergenic
938775024 2:134534059-134534081 CTGGACCTAAAGAAGGAGATGGG - Intronic
942329836 2:174810998-174811020 CTTCTCCTACAGTGGCTGATGGG + Intronic
943364828 2:186958905-186958927 CAGCTACTCCAGAAGATGATGGG + Intergenic
943635773 2:190305350-190305372 ATGCTCCTGCTGAAGGTGCTAGG + Intronic
945742931 2:213685439-213685461 ATGCTCCCACTGAAGGTGCTAGG - Intronic
947935629 2:234001186-234001208 CTTCCCCTACAGCAGGTCATAGG - Intronic
1169158638 20:3356824-3356846 CTGGTCATATGGAAGGTGATTGG - Intronic
1170399772 20:15968995-15969017 CTGATTCTACAGAAGGTGTCTGG + Intronic
1171372406 20:24670174-24670196 CTGCTCCTGCTGATGGTGTTTGG + Intergenic
1174131420 20:48345986-48346008 ATGCTCCTTTAGAAGGTGCTTGG - Intergenic
1176062941 20:63180109-63180131 CTGGTCCTAGAGAAGGGGAAGGG + Intergenic
1178428106 21:32495272-32495294 CTGCTCCTCCTGAAGCTGTTTGG + Intronic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1181805003 22:25369439-25369461 CTGCGCCCACAGAAGGTGGGTGG - Intronic
1183601924 22:38844665-38844687 CTGCTCCTTCAGAAGGTTGGAGG - Intergenic
1183732465 22:39626338-39626360 CTGCTGCTAGATAAGGTGCTGGG + Intronic
949179393 3:1110078-1110100 CTGTTCCTAAAGAAGGACATTGG - Intronic
951645996 3:24891919-24891941 CTGCACCCACAGAAGTAGATGGG + Intergenic
952843361 3:37666819-37666841 CTGCTCCCACAGTGGATGATTGG + Intronic
953984594 3:47431753-47431775 CACCTCCTACAGTAAGTGATTGG - Intronic
954133395 3:48571066-48571088 CTGCCCCTACAACTGGTGATGGG + Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
956781661 3:72607888-72607910 ATGCTCCCACTGAAGGTGAGAGG - Intergenic
959287648 3:104437358-104437380 CTGCTCTTCCAGAATGTAATAGG + Intergenic
960285152 3:115819868-115819890 CTGCTCCTACAGAAGGTGATGGG - Intronic
960894068 3:122483064-122483086 CTGCTCCTACAAAAGTGGACAGG + Intronic
964489399 3:157219047-157219069 ATGTTCATAAAGAAGGTGATGGG - Intergenic
964667603 3:159191224-159191246 CTGAGCCTAGAGAAGGTGCTGGG - Intronic
965664540 3:171078913-171078935 CTGCTGCAACAGAAGATGAAAGG - Intronic
965832282 3:172806019-172806041 CTGTTCCTAGAGATGGAGATGGG - Intronic
970859393 4:20684257-20684279 CTGCTCCTGCAGAAGGTGAAGGG + Intergenic
986636778 5:9830039-9830061 CTGCTCCCACAGCAGGTGGGAGG + Intergenic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
1002846434 6:949166-949188 CTCCCCTTAGAGAAGGTGATGGG + Intergenic
1004587125 6:17013330-17013352 TTCCTCCAACAGAAGGTGATGGG + Intergenic
1007137095 6:39532965-39532987 CTGCTACTACAGACTGTGCTGGG - Intronic
1008859170 6:56128408-56128430 CAGCTCATATGGAAGGTGATAGG + Intronic
1011730870 6:90261930-90261952 CTGCTCCTACAGAAGTTCATGGG - Intronic
1012386607 6:98690191-98690213 CTGCTCCTATCCAGGGTGATTGG - Intergenic
1013873414 6:114795695-114795717 TGGCACCCACAGAAGGTGATGGG + Intergenic
1015346791 6:132169832-132169854 CTGCCTCTACAGAAGAGGATAGG - Intergenic
1017210964 6:151855645-151855667 CTGCTTATACACAAGGTGAAAGG + Intronic
1018384083 6:163287327-163287349 CTGCTCTTACAGAAGGGAAAGGG + Intronic
1022227649 7:28380268-28380290 CTGGCCCTGCAGAAGGTGCTAGG + Intronic
1023652688 7:42388277-42388299 CTGTACCTACAGAAGGGGATGGG - Intergenic
1029299802 7:99571665-99571687 CTGCTCATAGAGAAGGAAATGGG - Intronic
1030375162 7:108745657-108745679 ATGCACCTGCAGAAGGTGGTTGG + Intergenic
1036085294 8:5607056-5607078 CTGCCCCTACAGACTGTGGTAGG - Intergenic
1036183537 8:6605101-6605123 CTGGTCCCACAGCAGGTGCTTGG + Intronic
1036584978 8:10115436-10115458 CTGCTCCCTCTGAAGGTGCTAGG - Intronic
1037419100 8:18683037-18683059 CTGCTCACACAGATGGTGGTGGG + Intronic
1038324850 8:26565318-26565340 CTGCTCCCACAGAAGTGGTTAGG + Intronic
1039039439 8:33393545-33393567 ATGCTCCTGCAGAAGGAGAGGGG - Intronic
1039571209 8:38587860-38587882 CTGCACCTGCAGAAGATGAAGGG - Intergenic
1040566958 8:48576133-48576155 CAACTCCTAAAGAAGGTAATGGG + Intergenic
1040616568 8:49043505-49043527 CAGCACCTACAGAAGGAGAAGGG + Intergenic
1044600330 8:93997383-93997405 CTTCTCCTACTATAGGTGATAGG - Intergenic
1044841636 8:96341795-96341817 GTGCTCATTCAGAAGGTGTTTGG - Intergenic
1044927767 8:97223957-97223979 GTGCTCTTAGAGAAGGTGAATGG - Intergenic
1046641866 8:116740395-116740417 CTGCTTCTACAGGAGATGACAGG + Intronic
1048893132 8:138965541-138965563 CAGTTCTTACAGATGGTGATGGG + Intergenic
1049377634 8:142296603-142296625 CTGCCCTGACAGAAGGTGAGCGG - Intronic
1049777865 8:144414781-144414803 CTGCTCCAACAGCAGCTGAGTGG - Exonic
1051520379 9:17980880-17980902 CTGCCCATGCAGAAGGTGAAGGG + Intergenic
1053031346 9:34781773-34781795 CTCCCCCTACAGAAAATGATGGG - Intergenic
1055829391 9:80360475-80360497 CTGCTGCTGCAGAGGGTGAGTGG + Intergenic
1056089855 9:83194892-83194914 CTGATACTACAGAAGGTTATAGG + Intergenic
1058103666 9:100945568-100945590 TTGCTTGTGCAGAAGGTGATTGG + Intergenic
1058874277 9:109229603-109229625 CAGCTCCTCCAGAAGGTGTGTGG - Intronic
1062412605 9:136432576-136432598 CTGTTCCCACAGCAGGTGACGGG - Exonic
1190817268 X:53939436-53939458 TTGCTGCTACAGGAGGTCATAGG - Intronic
1196794419 X:119490768-119490790 CTGCACCTGCAGAGGGAGATTGG - Intergenic
1196872509 X:120126071-120126093 GTGCTCCAGCAGAAGGTGAAAGG - Intergenic
1198364464 X:135926804-135926826 CAGCTACTACAGAGGCTGATGGG + Intergenic
1200002340 X:153068555-153068577 CTGCTGCCACAGAAGGTTCTTGG + Intergenic
1200005384 X:153081455-153081477 CTGCTGCCACAGAAGGTTCTTGG - Intergenic
1200888547 Y:8297607-8297629 CAGCTCCTAAAGAAGGTTAGCGG - Intergenic
1200983766 Y:9285667-9285689 CAGCACCTCCAGAAGGTGGTGGG + Intergenic