ID: 960285241

View in Genome Browser
Species Human (GRCh38)
Location 3:115820922-115820944
Sequence CTGCCAGGATTTGGGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960285241_960285246 -7 Left 960285241 3:115820922-115820944 CCTTATTTCCCAAATCCTGGCAG 0: 1
1: 0
2: 1
3: 23
4: 230
Right 960285246 3:115820938-115820960 CTGGCAGGTAGAACATTTTCTGG 0: 1
1: 0
2: 0
3: 14
4: 154
960285241_960285248 -3 Left 960285241 3:115820922-115820944 CCTTATTTCCCAAATCCTGGCAG 0: 1
1: 0
2: 1
3: 23
4: 230
Right 960285248 3:115820942-115820964 CAGGTAGAACATTTTCTGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 167
960285241_960285247 -4 Left 960285241 3:115820922-115820944 CCTTATTTCCCAAATCCTGGCAG 0: 1
1: 0
2: 1
3: 23
4: 230
Right 960285247 3:115820941-115820963 GCAGGTAGAACATTTTCTGGAGG 0: 1
1: 1
2: 0
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960285241 Original CRISPR CTGCCAGGATTTGGGAAATA AGG (reversed) Intronic
901612591 1:10510662-10510684 CTGCCAGGAGCTGAGCAATACGG - Intronic
903356754 1:22753208-22753230 CAGCCAAGATTTGGGAAAACTGG - Intronic
905382556 1:37573443-37573465 CTGCCAGGGTGAGGGAAATGGGG + Intronic
906089772 1:43168946-43168968 CTGCGAGCACTTAGGAAATACGG - Exonic
906519952 1:46461028-46461050 CTGCCAGTATCTGGGAAAAGGGG - Intergenic
908068763 1:60435387-60435409 CTCCCATGATGTGGGAAATGTGG + Intergenic
908423578 1:63983304-63983326 CTGCCAGGCTTTGGCAACTTGGG - Intronic
908664846 1:66478503-66478525 CTGGCAGGATTTTGGAGAAAAGG + Intergenic
908856410 1:68434511-68434533 CTGCAAGATTTTGTGAAATAAGG + Intronic
909202533 1:72709535-72709557 CTGCCAGCAGTTGGGCAACATGG - Intergenic
910730146 1:90386273-90386295 ATGCAAGGGTTTGAGAAATAAGG + Intergenic
911423217 1:97672425-97672447 CTCCCAAGATTTTGGAAATGAGG - Intronic
911603718 1:99876256-99876278 CTAGCAGGATGTGAGAAATAGGG - Intronic
911926021 1:103834104-103834126 CTGCCAAGAAGTGGGAATTATGG - Intergenic
912382185 1:109253684-109253706 CTGCCAAGAATTGTGAAAAAAGG + Intronic
913200028 1:116488463-116488485 CTGCCAGAATTTGGAAAGTTGGG + Intergenic
913710147 1:121474481-121474503 CTCCCATGATGTGGGAATTATGG + Intergenic
915643858 1:157252694-157252716 CAGCCAGGACCTGGGAAAGAAGG + Intergenic
915665116 1:157437469-157437491 CAGCCAGGGTTGGGGAAAAAAGG - Intergenic
916729100 1:167550552-167550574 CTGTCAGGACTTGGGAACTGAGG + Intronic
917295967 1:173519668-173519690 CTGCCAGTATTTATGAAATACGG - Intronic
917929926 1:179816082-179816104 CTGCCAGGATTAGGGCAAGAGGG - Exonic
918225295 1:182475686-182475708 CTGGCAGGAGATGGGAAATCAGG - Intronic
918778281 1:188666192-188666214 CTGCCAGGAGTTAGGCAAGAAGG - Intergenic
921100375 1:211923663-211923685 CTCCCAGGAATTGGGAATTTTGG + Intergenic
922357991 1:224795053-224795075 CTGCCTGGAGTTCGGAAAGAAGG + Intergenic
922372769 1:224927980-224928002 CTGTCAGGGATTGGGAAGTAAGG + Intronic
923252984 1:232194189-232194211 CTGCCACGTTTTGGGCAATCTGG - Intergenic
923423350 1:233843171-233843193 CTGCCATGACTTGGGAAATGGGG - Intergenic
924521243 1:244808144-244808166 CTACCAGTTTATGGGAAATATGG + Intergenic
1062997461 10:1880544-1880566 CTGCCAGCCTGTGGGAAAGATGG + Intergenic
1063176388 10:3554427-3554449 CTGCCAAGATTTGGGACCTGAGG - Intergenic
1064611638 10:17109428-17109450 CTGCTCTGATTTAGGAAATAAGG - Intronic
1067232098 10:44419147-44419169 CTTCCAGGCTGTGGGAAAAAAGG - Intergenic
1070521997 10:77262035-77262057 CTGGCAGGGTTTGAGAAGTAGGG - Intronic
1072259897 10:93659734-93659756 CTCCCATGAATTGGGAATTATGG + Intronic
1072540978 10:96397816-96397838 CTACCAGGATGGGGAAAATATGG - Intronic
1073858961 10:107713901-107713923 CTGCAACGATTTGGGAAACTCGG + Intergenic
1073896804 10:108170628-108170650 CAGCAAGGATTTGGGAGAAATGG - Intergenic
1074221620 10:111443767-111443789 CAGCCAGGCTTTGGAAGATAGGG - Intergenic
1075216275 10:120539042-120539064 CTGACAGCACGTGGGAAATACGG - Intronic
1075680308 10:124326462-124326484 ATCCCAGGATTTGAGAAATAGGG - Intergenic
1076737015 10:132463431-132463453 CTGTCAGGATTTGGGGACTCTGG - Intergenic
1077418283 11:2436190-2436212 CTGGCAGGGTTTGGGCAATGGGG - Intergenic
1078335297 11:10458334-10458356 CTGGCAGGTTTTGGCAATTAGGG - Intronic
1078558624 11:12351733-12351755 ATGCCAGGAATTGGGAAGAAGGG + Intronic
1079148828 11:17879234-17879256 CTGCTAGCAGTTGGGACATATGG - Intronic
1079680382 11:23289160-23289182 CTGACAGAAGTTTGGAAATAAGG - Intergenic
1083830862 11:65232757-65232779 CTGGAGGAATTTGGGAAATAAGG - Intergenic
1084394884 11:68903059-68903081 CTTCCAAGTTTTGGGAATTATGG + Intronic
1086606916 11:88706665-88706687 CTGGGAGGATTTGGTAGATAAGG - Intronic
1088046209 11:105455387-105455409 TTGCCAATATTTTGGAAATAGGG - Intergenic
1088662660 11:112063488-112063510 CAGACAGGATTTGGGATAAATGG - Exonic
1090653540 11:128825847-128825869 TTGCCAGGATTTGGGGAGGAGGG - Intergenic
1090875314 11:130783812-130783834 CCGCCTTGATCTGGGAAATATGG + Intergenic
1091077793 11:132637259-132637281 CTGCCAGGATTGGAAAAAAACGG - Intronic
1091158336 11:133395007-133395029 CTGGCAGGATGTGGAAAAAAGGG - Intronic
1092825607 12:12395878-12395900 ATGACAGGATTTGGCAAATTGGG + Intronic
1093558925 12:20514286-20514308 TTGACATGGTTTGGGAAATAAGG + Intronic
1095793929 12:46196560-46196582 TTGGAAGGATTTGGGAATTAAGG + Intronic
1096848608 12:54421207-54421229 TTCCCAGGATTTGGGAGATTAGG + Intergenic
1097315821 12:58170694-58170716 CTCCCATGATGTGGGAATTATGG - Intergenic
1097640767 12:62178518-62178540 TTGCCAGGATCTGTGAAATATGG - Intronic
1099666997 12:85644069-85644091 TAGACAGGATTGGGGAAATATGG - Intergenic
1101778866 12:107817739-107817761 CTGCTGAGATTTGGGAAACAAGG - Intergenic
1102398556 12:112609085-112609107 CTGTGAGGATTTGGGGAAGATGG - Intronic
1102784031 12:115589310-115589332 CTGCCAGGACTGAGGCAATAGGG + Intergenic
1104957116 12:132472430-132472452 CTGCCAGGACTTGGCAGATCCGG - Intergenic
1106319065 13:28621676-28621698 TTGCCAGGAACTGGGAAAAAAGG - Intergenic
1107515624 13:41125970-41125992 CTCCCATGATGTGGGAATTATGG - Intergenic
1108827125 13:54426469-54426491 ATGACAGGATTTGGACAATAAGG + Intergenic
1109198772 13:59408414-59408436 CTCCCAGAATCTGGGGAATAGGG + Intergenic
1109448257 13:62473840-62473862 CTGCCAGGGATTGGGCAATATGG - Intergenic
1110959244 13:81599823-81599845 CTGCCACCATTTGGGAAAAATGG + Intergenic
1112394951 13:99021014-99021036 CTGCCTTGATTTATGAAATATGG - Intronic
1115055781 14:29124679-29124701 CTCCCATGATGTGGGAATTATGG + Intergenic
1115631950 14:35254152-35254174 CTGACTGGATGTGGGAAACAAGG - Intronic
1116621931 14:47216005-47216027 CTAGCAGGGTTTGGGAAATCTGG + Intronic
1117183246 14:53214022-53214044 CAGCAAGGAGTTGGGAAACATGG - Intergenic
1120724400 14:87921848-87921870 CTCCCACGATGTGGGAATTATGG - Intronic
1121199521 14:92106109-92106131 CTGCCAGGATTAGGGTAGGAGGG + Intronic
1122620430 14:103054310-103054332 CTGGCAAGATTTGGGAAGTGGGG + Intronic
1124120009 15:26881074-26881096 CTGCCAGGATTTTGGTATGATGG + Intronic
1125191759 15:37001693-37001715 CCTTCAAGATTTGGGAAATATGG + Intronic
1126478933 15:49096333-49096355 CTGCCAGGAGTTGGGAGAGCTGG + Intergenic
1128145673 15:65331263-65331285 CTGCCAGCATTGGTGAAATGAGG + Intronic
1128154964 15:65386282-65386304 CTGCCAGCATCTTGGAAAGAGGG - Intronic
1129080425 15:73034567-73034589 ATGTCATGTTTTGGGAAATATGG - Intergenic
1129487171 15:75885451-75885473 CTGCAAGGTTTTGGGAAACCAGG + Intronic
1134162061 16:11899510-11899532 CTGACAGGAGTTGGGAGAAAGGG + Intronic
1135157982 16:20070688-20070710 CTGCGAGAATTTGGGAAACTTGG + Intronic
1137754763 16:50892532-50892554 CTGTCAGGCTTTGGGGCATAGGG + Intergenic
1138158541 16:54729837-54729859 TTGCCAGGAGTTGGGAAGAATGG - Intergenic
1138753697 16:59456270-59456292 CAGGCAGTGTTTGGGAAATATGG - Intergenic
1138872379 16:60906828-60906850 GTGCCAGGTTTTGGGTAAAAAGG - Intergenic
1141220718 16:82067185-82067207 CCGCCAAGAATTGGGAAATAAGG - Intronic
1142623153 17:1177669-1177691 ATTCCAGGCTTCGGGAAATAGGG + Intronic
1143923822 17:10351981-10352003 ATGCCAGGAGCTGGGATATATGG + Intronic
1144543013 17:16163972-16163994 CTGCCAGGGGTTGGGGAAAAGGG + Intronic
1144569772 17:16389713-16389735 CTGCCAGGAGCTGGGAAAGGAGG + Intergenic
1144800283 17:17921583-17921605 GTGCCAGGCTTTGGGGAAGAGGG + Intronic
1146648182 17:34589358-34589380 CTGGCAGGCTGAGGGAAATAGGG + Intronic
1147306783 17:39569652-39569674 CTGCCAGGATCTGGGAAATTAGG - Intergenic
1152383887 17:79957248-79957270 CTTCCAGGTTTTGGCAATTATGG - Intronic
1155085454 18:22453775-22453797 AAGCCAGGATTTGGGGCATAAGG + Intergenic
1155786459 18:29908409-29908431 TTGCCAGAAATTGGGAACTAGGG - Intergenic
1155983077 18:32200942-32200964 ATGCCAGGCTTTGGAAAATGAGG - Intronic
1156529152 18:37798232-37798254 TTTCCAGGATCTTGGAAATACGG - Intergenic
1156953453 18:42933457-42933479 CTTCCAGGATGTGGGAATTATGG - Intronic
1157686888 18:49650133-49650155 CTGCCAGGACTAGGGGAAGAGGG + Intergenic
1159573021 18:70142199-70142221 CTGGCAGGAGTTGGCAACTATGG - Intronic
1160252858 18:77218849-77218871 CTGCCAGGCTTTGGGAGGAAGGG - Intergenic
1160420440 18:78740341-78740363 CTGCCAGTATTTGTGAGATGAGG - Intergenic
1161926809 19:7306915-7306937 CTGCCAGGAGAGGGGAAAGAGGG + Intergenic
1162192075 19:8954812-8954834 CTGCCAGGATGGGGGAAGTAGGG + Exonic
1165076461 19:33282287-33282309 CAGCCAAGGTTTGGGAAATTAGG + Intergenic
1165472575 19:36011669-36011691 CTACCAGGATTTAGGAATCAGGG + Intronic
1168021635 19:53613039-53613061 ATGGCAGGATTTGGGGAAAAGGG + Intergenic
1168078805 19:53994380-53994402 CAGCCATGATTTGGGAAAGGAGG - Intronic
926447946 2:12967813-12967835 CTGCCAGAAGTTGGGCAAAATGG + Intergenic
927108274 2:19845977-19845999 CTGCCAGAACTCAGGAAATATGG - Intergenic
927458971 2:23281176-23281198 TTTTCAGGATTTGGGAGATATGG + Intergenic
928277863 2:29919567-29919589 CAGCACAGATTTGGGAAATATGG - Intronic
928457020 2:31431362-31431384 CCGACAGGAATTGGGAAAGAAGG + Intergenic
928583743 2:32736174-32736196 CTGCCAGGGACTGGGAAATTAGG + Intronic
931318943 2:61157774-61157796 CTGCCTGAATTTGGAAACTAGGG - Intronic
932963163 2:76439713-76439735 CTGGCAGGATAGGGGGAATAGGG + Intergenic
933148729 2:78889218-78889240 CTGGCAGGCTTTGGGCTATAGGG - Intergenic
933324964 2:80823755-80823777 CTACCAAGCTTTGGGAAACAGGG + Intergenic
933467456 2:82672795-82672817 TTGACATGAGTTGGGAAATAGGG + Intergenic
935895749 2:107735676-107735698 GTGCCAGGATTTGGCTAATTGGG + Intergenic
936263896 2:110985214-110985236 CTGCCAGGATCTGGAAAAGTGGG - Intronic
937001943 2:118475676-118475698 CTAACTGCATTTGGGAAATAAGG - Intergenic
937298679 2:120825154-120825176 CTGCCATGATTTGGGAGTTTTGG + Intronic
937376943 2:121343647-121343669 ATGCCAGGGGTTGGGAAAGAAGG + Intronic
937439799 2:121906132-121906154 CAGCCAGGATTTCCTAAATATGG + Intergenic
937517058 2:122667338-122667360 CTGTCAAGATTTAGGCAATATGG + Intergenic
938130532 2:128711926-128711948 TTGCCAGGATCTGGGGAATGGGG - Intergenic
940060277 2:149558331-149558353 CTGCAAGGACTTGGGAAATGAGG - Intergenic
941451340 2:165664481-165664503 CAGCCAGAATTCGGAAAATAGGG - Intronic
942313700 2:174680103-174680125 CAGGCAGAATTTGGTAAATAAGG - Intronic
942865924 2:180674951-180674973 CTGCCAGCATTAAGGAATTAAGG + Intergenic
943944291 2:194039208-194039230 TTGCCAGGATTGGAGAAGTAGGG + Intergenic
945087452 2:206146902-206146924 CTGCCCGGCCTTGGGAAACAAGG - Exonic
946373268 2:219293610-219293632 CTACCAGGATTTTTTAAATATGG + Intronic
946465737 2:219910270-219910292 TTTCCAGAATATGGGAAATACGG - Intergenic
947252336 2:228121895-228121917 CTGGCAGGATATGAGAAAGATGG + Intronic
1169801392 20:9515718-9515740 CTGCCGGGGTGTGGGAAAGAAGG - Intronic
1170280204 20:14637930-14637952 CTGTCAGGATTTTGGAAGTCAGG + Intronic
1170592800 20:17783792-17783814 TTGCCAGGATCTGGGAACTAAGG + Intergenic
1170748831 20:19125620-19125642 CTGCCAGGAGCTGGGGAATAGGG - Intergenic
1172270070 20:33650097-33650119 CCTCAAGGATTTGGGAATTAGGG - Intergenic
1177952520 21:27556385-27556407 ATTGCAGGATTTGGGAAAAATGG - Intergenic
1179042716 21:37818115-37818137 TTCCTAGGGTTTGGGAAATAAGG - Intronic
1183165839 22:36146861-36146883 TTGCAGGGATTTGGGAATTATGG + Intronic
1183172164 22:36196594-36196616 TTGCAGGGATTTGGGAATTATGG + Intronic
950635260 3:14309786-14309808 CTTCCAGGTTTTGGCAATTATGG - Intergenic
950791819 3:15478049-15478071 GTGCCAGGATTTGGTATATCTGG - Intronic
950932608 3:16805519-16805541 ATGCCAGGATTGAGGAAATCTGG + Intronic
951673678 3:25213226-25213248 CAGCGAGGACTTGGGGAATAGGG - Intronic
954464638 3:50647235-50647257 GTGCCAGGATTTGGGCAAAAGGG + Intronic
956324103 3:68031633-68031655 CTGCTAGGCTTTGGGATTTATGG - Intronic
957391368 3:79576376-79576398 CTGGTAAGATTTTGGAAATATGG - Intronic
960285241 3:115820922-115820944 CTGCCAGGATTTGGGAAATAAGG - Intronic
960304661 3:116046327-116046349 CTGCCTGGAAGTGGAAAATATGG + Intronic
961097599 3:124171170-124171192 ATGTAAGGATTTGGGAAATTAGG + Intronic
965537404 3:169837509-169837531 CAGAGAGGATTTGGGAAATTCGG + Exonic
967605091 3:191435503-191435525 CCAACAGGATCTGGGAAATAGGG - Intergenic
968005072 3:195237043-195237065 CTGCCTGGGTTTGGGGGATAGGG + Intronic
968703190 4:2066335-2066357 CTGCCAGGACTTGGTAGAGATGG + Exonic
968824096 4:2880195-2880217 TTGCCATGGTTTGGTAAATAGGG + Intronic
970307322 4:14747220-14747242 CTTGCTGGATTTGGGAAAGAGGG - Intergenic
976044538 4:80929906-80929928 ATGCCAGGAGATGGGAAAGAAGG - Intronic
979650185 4:123120029-123120051 CTTCCATGATGTGGGAATTACGG + Intronic
982717763 4:158826892-158826914 CTGCCAGTATTTGGTCAGTATGG - Intronic
983016733 4:162622622-162622644 CTGGCAGGGCTTGGGAAAAAAGG - Intergenic
985971007 5:3378315-3378337 CAGCCTGGATTTGGAAAATGCGG + Intergenic
986495333 5:8335690-8335712 CTGTCAGTCTTTGGGAAATGTGG + Intergenic
986744810 5:10734453-10734475 CAGCCAGGATCTCGGACATATGG + Intronic
989541650 5:42625800-42625822 CTGCCTGGATCTGGGAAGGAAGG + Intronic
990113548 5:52359246-52359268 CAGTCAGGATTTTGGAAATGGGG - Intergenic
993742576 5:91559036-91559058 CTGCCAGGCTTTGGTAAAACAGG - Intergenic
995658948 5:114459885-114459907 CTGAGAGTATTTGGCAAATAAGG + Intronic
996006759 5:118430188-118430210 CTAGTAGGATTTGGGAAATAAGG - Intergenic
996560377 5:124821934-124821956 TTCCCAAGATTTGGGAAAGAGGG - Intergenic
997292716 5:132748802-132748824 CTGACTGGAGGTGGGAAATATGG - Intronic
1000639765 5:163687816-163687838 CTGCCAGGCTGCGGGAAAGATGG + Intergenic
1001791648 5:174462757-174462779 ATTCCAGGATTTGGCAATTATGG + Intergenic
1002769742 6:280915-280937 CTCACTGGATTTGGGAAATGGGG - Intergenic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003421602 6:5963409-5963431 CTGCAAGGATTGGGGCAACATGG - Intergenic
1008126974 6:47679564-47679586 CTGCCTGGTTTTTGTAAATAAGG - Intronic
1008867345 6:56228666-56228688 GTGCCAGGATTTGAGTAATGGGG + Intronic
1013724460 6:113076639-113076661 CTGCCAGGATTTGGAAAGTGTGG - Intergenic
1013741594 6:113293256-113293278 CTGTCAGGATTTTTGAAATATGG + Intergenic
1016173680 6:141051629-141051651 CTCAGAGGATTTGGGAAATTTGG - Intergenic
1016694758 6:146979963-146979985 CAGCCTGGATGTGGGAAGTAGGG + Intergenic
1019402068 7:860954-860976 CTGCCACAATGTGGGAATTATGG + Intronic
1022827676 7:34032900-34032922 CTGAGAGGATTTGAGAAAGAGGG + Intronic
1027226195 7:76245031-76245053 CTGCCAGGAGTTGGGATGTATGG + Intronic
1027982369 7:85241922-85241944 CTGCCAGGATGTGGAGAAAAGGG + Intergenic
1028939789 7:96508505-96508527 GGGCCAGGAATTGGGAAATCTGG - Intronic
1029075031 7:97928314-97928336 CTGCCTGCATTTGGGGAAGAAGG + Intergenic
1030770218 7:113465468-113465490 CTGAAATGATGTGGGAAATAGGG + Intergenic
1030778541 7:113567589-113567611 CTGCCAGGAGATAGGGAATAGGG + Intergenic
1031674082 7:124588073-124588095 CTGACAGCATGTGGGAATTATGG - Intergenic
1031808553 7:126337541-126337563 CTTCTGGGAGTTGGGAAATATGG - Intergenic
1032168253 7:129562696-129562718 CTGCCAGGCATTGGGAACTTTGG - Intergenic
1032236323 7:130126779-130126801 TTGGCAGAAGTTGGGAAATATGG + Intronic
1033958263 7:146879596-146879618 CTTCCAAGATATGGGAATTAAGG + Intronic
1035606378 8:932718-932740 ATGTCAGGGTTTGGGAAATCAGG + Intergenic
1035917207 8:3637769-3637791 CTCCCAAGATGTGGGAATTATGG - Intronic
1036038003 8:5041122-5041144 CTGCCAGGACCTGGCACATATGG + Intergenic
1039081908 8:33741726-33741748 CTGCTAGGAGTTGGGATATGTGG + Intergenic
1039475606 8:37837906-37837928 CTGCCAGCACTTGGGCAATGTGG + Exonic
1040805745 8:51394602-51394624 CTGCCAGGTAGTGGGACATAGGG + Intronic
1046746015 8:117876930-117876952 CTACCAGGCTGTGGGAAAAAAGG + Intronic
1046781981 8:118225407-118225429 CTGGCAGCATTTGGGAAGTGAGG - Intronic
1046858598 8:119065284-119065306 CTGACAGGAGGTGGGAACTAAGG - Intronic
1047826364 8:128580718-128580740 CTGCCAGGCTTGGGTAAAGAGGG + Intergenic
1048046213 8:130775643-130775665 CTCCCATGATGTGGGAATTATGG - Intergenic
1048590250 8:135814688-135814710 CTGCCGGGAGATGGGAAAGAAGG + Intergenic
1048678244 8:136809294-136809316 CTGCCGGTATTTGGTACATAAGG + Intergenic
1048989946 8:139755330-139755352 GAGCCAGGATTTGGGGTATAAGG + Intronic
1051002521 9:12302244-12302266 CAGCCAGGAATTGAAAAATAAGG + Intergenic
1051799184 9:20912328-20912350 ATGCTAGAATTTGGGAATTATGG + Intronic
1055122240 9:72674734-72674756 CCTCCAGGATTTGGGAGACAGGG + Intronic
1058060782 9:100493445-100493467 CTGCCAGAAGTTGGGAATTTGGG + Intronic
1058341514 9:103903337-103903359 TTGCCATGGTCTGGGAAATATGG - Intergenic
1058646505 9:107135960-107135982 CTGTAAGGATTTGGGGATTAGGG - Intergenic
1061448760 9:130657299-130657321 CTACGTGGCTTTGGGAAATATGG - Intergenic
1061634152 9:131895448-131895470 CTGCAAGGAATGGGGATATAAGG - Intronic
1185891605 X:3827180-3827202 CTGCCAGGGTTGGGGAAAAAGGG + Intronic
1185896716 X:3865595-3865617 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1185901834 X:3904022-3904044 CTGCCAGGGTTGGGGAAAAAGGG + Intergenic
1186246942 X:7624928-7624950 CTCCCAGGACATGGGAAGTATGG - Intergenic
1187977884 X:24722079-24722101 CTACCAGGATGTGTGAAAAAAGG + Intronic
1189836203 X:45025599-45025621 CTGCCAGGATGTGAAAATTAGGG - Intronic
1189889374 X:45583081-45583103 CTGCCACCATTTGGGAAGCAAGG + Intergenic
1192015963 X:67331279-67331301 TTGCCAGGATTTGGGAGTTGGGG + Intergenic
1192509531 X:71713701-71713723 CTGACAGAATTTGGTAACTAAGG + Intergenic
1192517166 X:71767852-71767874 CTGACAGAATTTGGTAACTAAGG - Intergenic
1194112389 X:89851311-89851333 CTTCCAGGTTTTGGTAATTATGG - Intergenic
1194693638 X:97017791-97017813 GTGCCAGTAATTGGGAAAAAAGG - Intronic
1194871492 X:99138108-99138130 CTGCCAGCATTTGAGAAATGAGG - Intergenic
1195960581 X:110382379-110382401 CAGCCAGGATCTGGGAGACATGG + Intronic
1196262704 X:113603416-113603438 TTGCCAGGAGTTGGGAGAAAGGG + Intergenic
1196509328 X:116488219-116488241 TTGCCAGGAATTGGGGATTAGGG + Intergenic
1198150724 X:133906237-133906259 CTGCCATTATTAGGGAAAGAAGG + Intronic
1198616253 X:138462092-138462114 TTGCCAGGGTTTGGGAGAAAGGG + Intergenic
1199232887 X:145459695-145459717 CTACCAGGATGAGGGAAATATGG - Intergenic
1200443619 Y:3237704-3237726 CCCCCAGGATTCAGGAAATACGG - Intergenic
1200465043 Y:3506115-3506137 CTTCCAGGTTTTGGTAATTATGG - Intergenic
1200873433 Y:8127202-8127224 AAACCAGTATTTGGGAAATACGG + Intergenic
1202114420 Y:21456956-21456978 CTCCCAGCAGTTGGGAAAGAGGG - Intergenic