ID: 960285248

View in Genome Browser
Species Human (GRCh38)
Location 3:115820942-115820964
Sequence CAGGTAGAACATTTTCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960285239_960285248 2 Left 960285239 3:115820917-115820939 CCTTGCCTTATTTCCCAAATCCT 0: 1
1: 0
2: 1
3: 30
4: 400
Right 960285248 3:115820942-115820964 CAGGTAGAACATTTTCTGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 167
960285241_960285248 -3 Left 960285241 3:115820922-115820944 CCTTATTTCCCAAATCCTGGCAG 0: 1
1: 0
2: 1
3: 23
4: 230
Right 960285248 3:115820942-115820964 CAGGTAGAACATTTTCTGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 167
960285238_960285248 11 Left 960285238 3:115820908-115820930 CCAGGAGGTCCTTGCCTTATTTC 0: 1
1: 0
2: 2
3: 11
4: 271
Right 960285248 3:115820942-115820964 CAGGTAGAACATTTTCTGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 167
960285237_960285248 20 Left 960285237 3:115820899-115820921 CCAATGGGGCCAGGAGGTCCTTG 0: 1
1: 0
2: 3
3: 24
4: 199
Right 960285248 3:115820942-115820964 CAGGTAGAACATTTTCTGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960285248 Original CRISPR CAGGTAGAACATTTTCTGGA GGG Intronic
904979349 1:34483889-34483911 AGGGAAGAACAATTTCTGGAAGG + Intergenic
906348705 1:45038557-45038579 GAGGTAGAACAGAGTCTGGAAGG + Intronic
909562681 1:77023824-77023846 CAGGAAGAACAGTTTCTCAAAGG + Intronic
912198788 1:107431635-107431657 AAGGTAGGAGATTTTCTGGGTGG - Intronic
916078967 1:161220260-161220282 CAGGTTGATCAATATCTGGAAGG + Intronic
916393529 1:164359785-164359807 CAGGTGGAAGATTTTAAGGAGGG - Intergenic
916853707 1:168728611-168728633 TAGGTAGAACAGCTTCTGGAAGG + Intronic
920455144 1:206095485-206095507 TATTTAGAAAATTTTCTGGAAGG + Intronic
920653816 1:207859787-207859809 CAGGAAGAACATATTGGGGAGGG + Intergenic
921883877 1:220284638-220284660 GCTGTAGAACATTTTCTGAAAGG - Intergenic
1064177154 10:13085105-13085127 AAGCCAGAACACTTTCTGGAAGG - Intronic
1066510876 10:36094559-36094581 CAGATACAGTATTTTCTGGATGG + Intergenic
1067323951 10:45248744-45248766 CAGGGAGAACAGTTTTGGGAGGG - Intergenic
1068723549 10:60274482-60274504 CAGGTAGGACTTGTCCTGGATGG + Intronic
1074585363 10:114763190-114763212 CAGATAGAAAATTGTCTGGAAGG + Intergenic
1074602832 10:114932634-114932656 CAGAGAGAACAATTTTTGGATGG - Intergenic
1075638563 10:124048137-124048159 CAAGCAGAACATTTTGTGGGAGG - Intronic
1078162252 11:8851560-8851582 CAGGTTAAAGACTTTCTGGAGGG + Intronic
1078584784 11:12574007-12574029 CATAAAGGACATTTTCTGGAGGG + Intergenic
1080236991 11:30081465-30081487 CAGGAAGAACTTTATTTGGAAGG - Intergenic
1080398527 11:31912547-31912569 CAGGTAGAATATTTCCTGTTGGG + Intronic
1080540620 11:33260759-33260781 CAGGAATAACAACTTCTGGAAGG - Intronic
1082683560 11:56209948-56209970 CAGTTATAATATTTTCAGGAAGG - Intergenic
1084567192 11:69937704-69937726 CAGGTTGAACATTTAATGGACGG - Intergenic
1086862889 11:91946042-91946064 AATGTAGAATATTTTATGGAAGG + Intergenic
1087409383 11:97771738-97771760 CAGGTGGAAGATTTCCTGGTGGG + Intergenic
1089015942 11:115165351-115165373 CACGTAGAGCAAGTTCTGGAGGG - Intergenic
1090568364 11:128020529-128020551 AAGTTAGAACATTTACAGGATGG - Intergenic
1092632900 12:10403602-10403624 TAGTTAGAACATTTTCTGTGAGG - Intronic
1093675893 12:21940357-21940379 CATCTAGAGCATTTTCAGGATGG + Intronic
1093870320 12:24283485-24283507 CAGGTGGCATATTTTCTGAATGG - Intergenic
1095940984 12:47726636-47726658 CAGGTTGAACAGTTGCTGGTGGG + Intergenic
1096646337 12:53038908-53038930 CTGGTAGAACATTTCTTTGACGG + Intronic
1100171239 12:91977463-91977485 CAGTAAAAACATTTTCTAGATGG - Intergenic
1100524943 12:95410466-95410488 CATGTGGCACATTTACTGGATGG + Intergenic
1100609047 12:96175866-96175888 CAGGTAGAAAATGTCCTTGAAGG + Intergenic
1100900317 12:99232575-99232597 CAGGTTGAATATCTTCTTGATGG - Intronic
1101008468 12:100425943-100425965 CAGGAAGTTCATTTTCTGGGTGG + Intergenic
1101437181 12:104673800-104673822 CTGGCAGAACATTCCCTGGAAGG + Intronic
1102263477 12:111460368-111460390 CCAGTAGAACATTTTGTGGCTGG - Intronic
1105432721 13:20351869-20351891 CAGGCAGGAGACTTTCTGGATGG + Intergenic
1105626471 13:22117772-22117794 CAGGGATAAGATTTTCAGGATGG - Intergenic
1106153355 13:27127620-27127642 CAGGTTGAAGATTTTTAGGAGGG - Intronic
1108246832 13:48524639-48524661 CAGGTACAAAAGTTTTTGGAGGG - Exonic
1110373340 13:74764225-74764247 CAAGAAGAACATCTTCTGGTAGG + Intergenic
1113572230 13:111366241-111366263 CAGGTTCACCATTTTCTGTAAGG + Intergenic
1113748767 13:112764492-112764514 CAGGGAGAACTCTGTCTGGAAGG + Intronic
1115143783 14:30203206-30203228 CAGGAAGTATATTTTCTGGGTGG + Intergenic
1115980624 14:39047896-39047918 CAGGTGGAAAATATTCTGTAAGG + Intronic
1117770677 14:59130955-59130977 CAGTTAAAACCATTTCTGGAAGG + Intergenic
1118335926 14:64853513-64853535 CAGGGAGAACAGTTTCAGTAGGG + Intronic
1118844544 14:69536985-69537007 CATGCAGAACTTTTTCTTGAAGG + Intergenic
1120997330 14:90426662-90426684 CAAGTAGAATTTTTTCAGGAGGG - Intergenic
1121975041 14:98395593-98395615 CTGTTAGAAAATTTTCTGGGCGG - Intergenic
1124173390 15:27398220-27398242 CAGGAACAACAGTTTCTGGATGG + Intronic
1125074470 15:35597225-35597247 CAGAGAGAACATTTTCAGCAGGG - Intergenic
1127836849 15:62797216-62797238 CAGGGAGAACATTCTCAAGACGG + Exonic
1128247354 15:66142174-66142196 CTGTTAGAGTATTTTCTGGATGG - Intronic
1128394996 15:67215555-67215577 CAGGAAAAACATTTTGTGCAGGG - Intronic
1128563492 15:68683723-68683745 GAGGTAGAACATGCTCTGCAGGG - Intronic
1131042385 15:89282705-89282727 CAAGTGTGACATTTTCTGGATGG + Intronic
1131318746 15:91366314-91366336 CAGGCAATACATTTTCTGGGCGG + Intergenic
1131968267 15:97867936-97867958 CTGGCAGAACATTTCCAGGAGGG + Intergenic
1135129215 16:19838425-19838447 TAGGAAGCACATATTCTGGAAGG + Intronic
1137874949 16:51987229-51987251 CATGTGCAACGTTTTCTGGAAGG - Intergenic
1138538194 16:57671252-57671274 TAGGTACACCATTTTCTGGAGGG + Intronic
1139329734 16:66178011-66178033 CATTTAGAGCATTTTCTGAAGGG - Intergenic
1142479520 17:210273-210295 CATGTAGATGAGTTTCTGGAGGG + Intergenic
1142814435 17:2414220-2414242 CTGGTAGAAGGTTTTCTGAATGG + Intronic
1146685293 17:34837377-34837399 CTGGTAGAACATCTTCAGGGTGG - Intergenic
1151394416 17:73812795-73812817 CAGGTGGAACATTTTATTGTTGG - Intergenic
1152792846 17:82291485-82291507 CACGTAGAAGATCTTCTTGAGGG - Intergenic
1153999523 18:10472003-10472025 CCGGTAGAACATCCTCTGGGTGG - Exonic
1155636376 18:27960370-27960392 CAGGAAGAACATCTTGTAGATGG + Intronic
1157492715 18:48135756-48135778 GAGATAGAAGATTTTTTGGAAGG - Intronic
1158116713 18:54004438-54004460 CAGGGGGAGCATTTGCTGGAGGG - Intergenic
1158772068 18:60530960-60530982 TATGTAGAAAATTTTCTGGCTGG - Intergenic
1159265058 18:66069712-66069734 CACTTAGAACACTTCCTGGAGGG + Intergenic
1162809818 19:13156994-13157016 GAAGAAGAACATATTCTGGAGGG + Intergenic
1166779054 19:45330701-45330723 CAGCGAGAACATTTTCTTGGAGG - Intergenic
1167199604 19:48055183-48055205 CAGGGACAACATCTTCTGTAAGG + Intronic
1168385841 19:55962590-55962612 CGGGCTGAACATTTTATGGATGG - Intronic
925035958 2:686003-686025 CAGGCAGAAGGTTTTCTGCAGGG + Intergenic
926023425 2:9517143-9517165 CAGGGATAGCATTTTCTGGGTGG - Intronic
927050018 2:19318914-19318936 AATGTAGAACATGTTCTGCATGG + Intergenic
928433573 2:31239503-31239525 CAGGCAAAACATTTACTGGGAGG + Intronic
929938889 2:46315454-46315476 CAGGTACATCAAGTTCTGGATGG + Intronic
929980290 2:46672426-46672448 GAGCTAGAAAATTTTCAGGATGG - Intergenic
933340928 2:81025415-81025437 GAGGTAGATCATTTTCTTGCTGG - Intergenic
936942943 2:117904264-117904286 CACATTTAACATTTTCTGGAAGG - Intergenic
938015087 2:127860159-127860181 CAGCTAGAATCTTTTCTGGCTGG - Intergenic
938750064 2:134319986-134320008 CAGGAAGAACATCTACTGGTGGG - Intronic
940399627 2:153232989-153233011 CCTGTAGAATAGTTTCTGGATGG + Intergenic
940969609 2:159881438-159881460 CAGGTAGAACATCTGCAGGCTGG + Intronic
941388969 2:164888533-164888555 CAGTTAGAAAGTTTTCAGGATGG - Intergenic
941970489 2:171345621-171345643 CACATAGAACATTTTCTCAATGG + Intronic
1170151570 20:13232031-13232053 CAGGTAGAATATTTTCACCAAGG + Intronic
1172593839 20:36135934-36135956 AAGGGAGGAAATTTTCTGGAGGG - Intronic
1174012270 20:47459640-47459662 CTGGTAAAACATTTCCAGGAGGG + Intergenic
1175596138 20:60235047-60235069 CAGGTAGACTTTTTTCTGTATGG + Intergenic
1176222320 20:63975507-63975529 CAGCTAGGACATTTTCCCGAAGG + Exonic
1177380828 21:20342267-20342289 TAGGTGGAACATTTTCTCTATGG + Intergenic
950092434 3:10305321-10305343 GAAGCAGAGCATTTTCTGGAGGG - Intronic
950914799 3:16633612-16633634 GAGGTTGAACATTTGCTGCATGG + Intronic
952869185 3:37882909-37882931 CACGTAGAACACTGTTTGGAAGG - Intronic
956058849 3:65329570-65329592 CAGACAGAATATTTTATGGATGG - Intergenic
956073781 3:65483378-65483400 AAGGTGGAATACTTTCTGGAAGG - Intronic
956574407 3:70735890-70735912 CTGGTAAAACATATTCAGGATGG + Intergenic
959073953 3:101730672-101730694 CATGTAGCACTTTTTATGGAGGG + Intronic
959285800 3:104408726-104408748 GTGGTAGAAAATATTCTGGATGG + Intergenic
960285248 3:115820942-115820964 CAGGTAGAACATTTTCTGGAGGG + Intronic
964578644 3:158205033-158205055 CAAGTGGACCAATTTCTGGATGG + Intronic
966038976 3:175457171-175457193 CAGGTAGAACATTTGATGTAGGG - Intronic
970686958 4:18579373-18579395 CAGGTGCAACATGTTCTGCAAGG + Intergenic
971110336 4:23577961-23577983 TAGATAAAACATTTTTTGGAAGG - Intergenic
974045922 4:56898421-56898443 CAGATATAACATTTTATGAAAGG + Intergenic
974108074 4:57493912-57493934 CAGGTAGAATATTTTCTTTATGG + Intergenic
974714474 4:65649575-65649597 GAGATAGGACATTTACTGGATGG - Intronic
975049828 4:69848523-69848545 ACTGTAGAACATTTTCTGTAAGG - Intronic
976193860 4:82514481-82514503 CAGGCAGTGCATTTACTGGATGG + Intronic
977495715 4:97772672-97772694 CAGATAGAACTTTTTCTTGTAGG - Intronic
977596070 4:98882544-98882566 AAGGTAGTAAATCTTCTGGAAGG - Intronic
978115459 4:105015047-105015069 AAGGAAGAACAGTTACTGGAGGG + Intergenic
978324766 4:107539963-107539985 CAGGTTGAAAATTTTCTGTGTGG - Intergenic
985363531 4:189201457-189201479 AAAGTAGAACATTACCTGGAAGG + Intergenic
986699722 5:10394353-10394375 CAGGTAAAACATTTCCTAAATGG - Intronic
992014843 5:72565320-72565342 CTGGTTGAACATATTCTGGCTGG - Intergenic
994502603 5:100599078-100599100 CAGGGACAACATTTTCTAAAGGG + Intergenic
996480615 5:123971504-123971526 CAGTTAGAACATTTGTTTGAGGG + Intergenic
997275260 5:132581534-132581556 CAGGTAAAATATACTCTGGAAGG - Intronic
999625673 5:153517801-153517823 CAGGTGGAACATTGTCTGGAAGG - Intronic
1001295797 5:170498007-170498029 CCGGTTGATCATGTTCTGGAGGG - Intronic
1001325898 5:170723756-170723778 CAGGTAGAAGATATTTTGGCAGG + Intronic
1003720321 6:8694090-8694112 CAGATAAAACATTTTTGGGATGG + Intergenic
1003873106 6:10416975-10416997 AAAGTCGACCATTTTCTGGACGG - Intronic
1004585259 6:16993549-16993571 CAGGCATCTCATTTTCTGGAGGG + Intergenic
1005061817 6:21783673-21783695 CCGGTAGGAGACTTTCTGGATGG + Intergenic
1007683280 6:43649104-43649126 CAGGAACAGCATTTTCTAGAAGG + Intronic
1007723373 6:43899453-43899475 GAGGAAGAACATGTTTTGGAGGG - Intergenic
1012921288 6:105223398-105223420 TATGTAGAACATTTTCCAGAGGG + Intergenic
1015365573 6:132393710-132393732 CAGGCAGAACACATTCTGGCAGG - Intronic
1015574955 6:134661323-134661345 CAGGCAAACCAGTTTCTGGAAGG + Intergenic
1015817981 6:137230125-137230147 CAGGTAGGAAATTTTCCAGAAGG + Intergenic
1016373446 6:143397239-143397261 CAGGAGAAACATTTTCTGGGAGG - Intergenic
1017881466 6:158565433-158565455 CAGGGAGAAGGTTTTCTGGATGG + Intronic
1019958205 7:4434172-4434194 CAATTAGAATGTTTTCTGGACGG - Intergenic
1020647797 7:10836389-10836411 CAGGTAAAACATTTTATTCAAGG + Intergenic
1021084565 7:16407276-16407298 CCTGTAAAACATTTTCTTGAGGG + Intronic
1025984168 7:66433193-66433215 CAGGTAAAACAATTTTTTGATGG + Intergenic
1028426996 7:90700468-90700490 CTGGTAGAAGATTATCTGGATGG - Intronic
1030494606 7:110283230-110283252 CAGGTAGTTAATCTTCTGGAAGG + Intergenic
1033827299 7:145207357-145207379 AGGGTAGAACATTTTTTGGAAGG + Intergenic
1035000140 7:155606061-155606083 GAGGTAGAACATTTTTTGTATGG - Intergenic
1036646951 8:10616908-10616930 CAGGGAATACATATTCTGGAGGG - Intronic
1037020834 8:13968244-13968266 CAGATAGAAAGTTTTCTGCAAGG - Intergenic
1041195324 8:55396155-55396177 GTGGTAAAACATTTTGTGGAAGG - Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1043045511 8:75318385-75318407 CATGGAGAACATTTTCTGATAGG - Intergenic
1044749344 8:95401201-95401223 CAGGTAGAAAAGTTTTTGAAAGG + Intergenic
1044959320 8:97515085-97515107 CAGGGAGAACACTATCTGGCAGG - Intergenic
1050434031 9:5590510-5590532 CAGGAACAACAGTTTGTGGATGG + Intergenic
1050450374 9:5774199-5774221 GAGGAAGAACCTTTTCAGGATGG + Exonic
1051039304 9:12787190-12787212 CATTTAGAACATTTCCAGGAAGG - Intronic
1051609424 9:18946856-18946878 GAAGTAGAACATTCACTGGATGG + Intronic
1056536781 9:87534995-87535017 TAGGAAGAGCACTTTCTGGAAGG + Intronic
1056687062 9:88775583-88775605 AAGGGAGACCATTTTCTGGGTGG + Intergenic
1056985340 9:91359330-91359352 TACGTTGAACATTTTCTGGAAGG - Intronic
1057453631 9:95187880-95187902 GAGGTAGAACGCTTTCAGGATGG + Intronic
1057474622 9:95388143-95388165 GAGGTAGAACGCTTTCAGGATGG - Intergenic
1057906245 9:98985802-98985824 CAGGTAGATGACCTTCTGGAAGG - Exonic
1058779014 9:108314745-108314767 TAGGAAAAAAATTTTCTGGAAGG + Intergenic
1059239036 9:112787271-112787293 CAGGGAGAACCTGTTCTGTACGG + Intronic
1059691811 9:116692255-116692277 CAGGTAAAACAATTTCTAGGAGG + Intronic
1060611644 9:124971109-124971131 AAAGTAGAACATTTTCTGGCTGG - Intronic
1060744217 9:126119682-126119704 CAGGTAGAGCATTTGCTCAAAGG + Intergenic
1061032048 9:128091028-128091050 CAGGCAGCTCATCTTCTGGAGGG + Intronic
1061772141 9:132933556-132933578 CTGGTAGATGGTTTTCTGGAAGG - Intronic
1186735319 X:12457210-12457232 CTTGAAGAACATTTTCTGGTGGG + Intronic
1187046896 X:15655814-15655836 CTGGCATAATATTTTCTGGAGGG - Intronic
1188716585 X:33465703-33465725 CAGGGGGAACAATTACTGGAGGG + Intergenic
1191669247 X:63733925-63733947 CAGTGAGAAAATATTCTGGATGG - Intronic
1193216504 X:78870597-78870619 CAGGAAAAACATTTTGTGGAGGG + Intergenic
1196310138 X:114154330-114154352 CATTTAAAACACTTTCTGGAAGG + Intergenic