ID: 960290239

View in Genome Browser
Species Human (GRCh38)
Location 3:115875488-115875510
Sequence CCCAAATATCACTATGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960290237_960290239 14 Left 960290237 3:115875451-115875473 CCTATTACTAAAGGGTTCAGAAT 0: 1
1: 0
2: 0
3: 10
4: 140
Right 960290239 3:115875488-115875510 CCCAAATATCACTATGTGCTAGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960290239 Original CRISPR CCCAAATATCACTATGTGCT AGG Intronic
901925928 1:12565989-12566011 CCCAAAAGTCACTGTGTCCTTGG + Intergenic
902665858 1:17937527-17937549 CACAAATACCACTCTGTTCTAGG - Intergenic
902880793 1:19370573-19370595 CTGAAATTTCACCATGTGCTAGG - Intronic
904975578 1:34453653-34453675 CCCAAACTTCACTAGGGGCTAGG - Intergenic
908225710 1:62053901-62053923 GCCAAATACCACTATGTTCCAGG + Intronic
910219947 1:84880032-84880054 TCAAAACATCACAATGTGCTGGG + Intronic
910454295 1:87379870-87379892 CCCAAGTATCTCTATTTTCTTGG + Intergenic
910507830 1:87970298-87970320 CCAAATTTTCACTTTGTGCTGGG - Intergenic
911276521 1:95866531-95866553 TGCAAATAACACTATGTGCCAGG + Intergenic
913260887 1:116996915-116996937 ACCTCATATCACTATGTGGTAGG - Intergenic
918063262 1:181080544-181080566 TCCAAATAGCATTAAGTGCTCGG - Intergenic
921055834 1:211541787-211541809 CTCAAAACCCACTATGTGCTAGG - Intergenic
921203935 1:212831981-212832003 CCCATTTATCACTATCTGATCGG + Intronic
922499527 1:226086244-226086266 CCCAAATATCTTTATATTCTGGG + Intergenic
922923137 1:229325941-229325963 TCCAAATAACACCATTTGCTAGG + Intronic
1063641992 10:7839156-7839178 CCCAAAAATAACTATGTACCTGG + Intronic
1066587571 10:36953404-36953426 CCCAAATATGACTCTGTGACAGG - Intergenic
1077661674 11:4074158-4074180 CCAATATATCATTATCTGCTGGG + Intronic
1079621291 11:22558235-22558257 CCTAAAAAACACTATATGCTGGG - Intergenic
1082122719 11:48396705-48396727 CCTACAAAGCACTATGTGCTAGG - Intergenic
1085332591 11:75666606-75666628 ACTAATTACCACTATGTGCTAGG + Intronic
1086246199 11:84755802-84755824 CCCAATTTTCAATATATGCTAGG + Intronic
1086366611 11:86113449-86113471 GCCAAATATAACTCTGTTCTGGG + Intergenic
1091597231 12:1886328-1886350 CACCAAAATCACTATGTCCTTGG + Exonic
1092517903 12:9235041-9235063 CCCACATATCACTATCTTCAGGG + Intergenic
1093649652 12:21627914-21627936 CCCTAATATTAGTATGTGGTGGG - Intergenic
1094153491 12:27312560-27312582 CCAAAATATCTCTTTCTGCTCGG - Exonic
1097010582 12:55950999-55951021 CCCAAACATCCCAAAGTGCTGGG - Intronic
1097454504 12:59780726-59780748 TCCAATTACCACTATGTGTTGGG - Exonic
1097995624 12:65884911-65884933 CACATATAGCACTATGTGCCAGG - Intronic
1100541813 12:95564375-95564397 CACTTATATCACTATTTGCTAGG - Intergenic
1105763868 13:23538849-23538871 ACCAAAAAAGACTATGTGCTGGG - Intergenic
1106168265 13:27268299-27268321 CCCAGGTGCCACTATGTGCTGGG + Intergenic
1108239094 13:48443881-48443903 CCTACACATCACTATGTTCTGGG - Intronic
1108884693 13:55165466-55165488 CCCACACATCACTATGGGCATGG - Intergenic
1110137580 13:72087014-72087036 CCCCACTATCACTTTGTGCTAGG + Intergenic
1110989192 13:82015738-82015760 CCCAAATATGAGTATGTTATAGG + Intergenic
1113528262 13:110999912-110999934 CCCAAATATCACCAGGTGTTGGG - Intergenic
1114409628 14:22488602-22488624 CCCAAATATCACCTTGTCGTAGG - Intergenic
1115186271 14:30691242-30691264 TCCAAATAACACTATGAGCTAGG - Intronic
1115676814 14:35685341-35685363 CCCAAATATCACATGATGCTGGG + Intronic
1116709065 14:48341738-48341760 GCTAAATTTCTCTATGTGCTGGG + Intergenic
1117085145 14:52192934-52192956 CCCAATCATAACTATTTGCTTGG - Intergenic
1117475753 14:56093157-56093179 CCCAAATATTACAATGTGCAGGG - Intergenic
1118585661 14:67350039-67350061 TCCAAATAACACTATGAGATAGG - Intronic
1120949203 14:90025543-90025565 ACCAAACATCACTAAGTACTGGG - Intronic
1134326048 16:13208833-13208855 CCCACATGACACTAGGTGCTGGG - Intronic
1138807352 16:60106784-60106806 ACCAAATATCTCTGTGCGCTGGG - Intergenic
1139089563 16:63628997-63629019 GCCAAAGATAACTCTGTGCTTGG - Intergenic
1148249214 17:46060488-46060510 CTCAGAAATCACTCTGTGCTTGG - Intronic
1148827755 17:50406660-50406682 ACCAAATGCCACTTTGTGCTTGG + Intergenic
1152700879 17:81818583-81818605 CGCATATGTCACTATCTGCTGGG - Intergenic
1153913646 18:9725983-9726005 CTCAAATAACTCTATGTGGTTGG + Intronic
1155789871 18:29952233-29952255 CCCAAATGCCACTATGGGTTAGG - Intergenic
1158065056 18:53396956-53396978 TATAAATATCACTTTGTGCTTGG - Intronic
1159506834 18:69349122-69349144 CCCTAAAATCACTGTGTGCCTGG - Intergenic
1159792915 18:72806146-72806168 CCCAAATATGATCATATGCTTGG - Intronic
1159956523 18:74522248-74522270 CCCAGATAGCACTGAGTGCTGGG - Exonic
1164089599 19:21936496-21936518 TCACAATCTCACTATGTGCTGGG - Intronic
1164193906 19:22936427-22936449 TCACAATCTCACTATGTGCTGGG - Intergenic
1165308741 19:35018245-35018267 CCCAAATTTCCCGAAGTGCTGGG + Intronic
1167029710 19:46949809-46949831 CCGAATGATCACTATGTGCCAGG - Intronic
925726352 2:6876057-6876079 CACAAACATCACTCTGTGCAGGG - Intronic
926732253 2:16044750-16044772 CTCAAATATCACTATATGGAAGG - Intergenic
927490006 2:23515046-23515068 CCCAAGTGTCTCTGTGTGCTGGG - Intronic
929124527 2:38511130-38511152 CCCAAATGAGAATATGTGCTAGG + Intergenic
929841056 2:45463568-45463590 CCCAAATATAAGATTGTGCTAGG - Intronic
931829880 2:66039773-66039795 CTCAAATATCAATATGTCCAGGG + Intergenic
932583367 2:73007071-73007093 CCCAAATATCTCAGTCTGCTTGG + Intronic
933584442 2:84165238-84165260 CCCTAATGTCAATATATGCTTGG + Intergenic
933670846 2:85005803-85005825 CTGAAATATCACTATGGGCTGGG - Intronic
935596231 2:104880196-104880218 CCCAAATCTGTCTATGTGGTGGG - Intergenic
939011726 2:136854778-136854800 CCCAAGTATCACCATGAGCTGGG - Intronic
939747269 2:145990686-145990708 TCCAAATATTATTATGTGCGTGG + Intergenic
942143035 2:172997094-172997116 CCCAAATATCACCTTCAGCTAGG - Intronic
945150192 2:206782864-206782886 TCTAAAAATTACTATGTGCTGGG - Intronic
945631317 2:212281417-212281439 CCCAAATATCCATATGTGACTGG - Intronic
946197743 2:218046098-218046120 TCAAAACATCACTATGGGCTGGG - Intronic
948565878 2:238885819-238885841 CCCAAACATCTCAAAGTGCTAGG - Intronic
1168893981 20:1311240-1311262 CCCAAATGTGACTGTGGGCTTGG - Intronic
1179251108 21:39672252-39672274 ACCAAGTATCACTATGTCTTTGG - Exonic
1184636228 22:45834277-45834299 CCCAAAGATCACCAGGTACTTGG + Intronic
949361297 3:3234805-3234827 CCCAAATATCTTGATGTTCTCGG - Intergenic
949375705 3:3387709-3387731 GCCAAATATTATTATTTGCTTGG - Intergenic
949920403 3:8995665-8995687 CCCAAATATCACTAGTTGTATGG - Intronic
950699831 3:14734602-14734624 ACCAAAATTGACTATGTGCTGGG - Intronic
955986078 3:64575373-64575395 GCCAAATAGCATTCTGTGCTAGG - Intronic
957522291 3:81334133-81334155 GCCAAATATAACCATTTGCTGGG - Intergenic
959230534 3:103645431-103645453 CCCAAACATCACTAGGTAATGGG - Intergenic
960290239 3:115875488-115875510 CCCAAATATCACTATGTGCTAGG + Intronic
960629571 3:119716406-119716428 ACCAACTATCTCTATGTCCTTGG - Intronic
960844319 3:121993004-121993026 CCCAAATTACACTGTGGGCTAGG - Intronic
962303226 3:134262048-134262070 CCCCAATGTGACTATGTGCTTGG - Intergenic
963065669 3:141261755-141261777 ACAAAATATTACTACGTGCTAGG - Intronic
963250584 3:143099412-143099434 CCCATAAATCACTATGTCCAAGG - Intergenic
963796662 3:149637566-149637588 CCCTAGTACCAATATGTGCTAGG + Intronic
965004522 3:163002331-163002353 CCCAAATCTCTCTATATGCTTGG - Intergenic
966216770 3:177511637-177511659 CCCAACTAACCCTATCTGCTTGG - Intergenic
967098983 3:186200514-186200536 CCCACTTATCAGAATGTGCTAGG + Intronic
968163218 3:196443964-196443986 CCTAAAAATCTCTAAGTGCTAGG - Intergenic
969886996 4:10223718-10223740 CCCTAATATCACAATCTGGTAGG + Intergenic
971503059 4:27337184-27337206 CCCCAAAATCTCTAGGTGCTAGG - Intergenic
973248392 4:48035348-48035370 CACCAATACCACTATGAGCTAGG - Intronic
974566522 4:63583843-63583865 CCCAAAGAGCACTCTGTACTGGG + Intergenic
975859346 4:78659708-78659730 CCCACCTATTACTATGTGCCAGG - Intergenic
976359736 4:84163340-84163362 CCCAAAATTTACTATGTGTTTGG - Intergenic
977159922 4:93621180-93621202 CCCAGATAACACTAGGAGCTAGG - Intronic
984359515 4:178710719-178710741 CTGAGATATCACTATGTGCCAGG - Intergenic
985437768 4:189948534-189948556 CTCTACTATCATTATGTGCTTGG - Intronic
987144404 5:14978329-14978351 ACCAAATATCACTGAATGCTTGG + Intergenic
990370506 5:55113737-55113759 CTAAAATCTCACTATATGCTAGG - Exonic
991157497 5:63456530-63456552 CTAAAATATCACTAGGTGATAGG + Intergenic
999873479 5:155776284-155776306 TCCAAATATCACTATGGCCAAGG + Intergenic
1010808653 6:80270387-80270409 CACAAAAATTGCTATGTGCTAGG - Intronic
1012781204 6:103559714-103559736 CCCTGTTGTCACTATGTGCTAGG - Intergenic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1014620154 6:123657887-123657909 CTCAAATATCACTACTTCCTGGG - Intergenic
1017281914 6:152635297-152635319 CCCAGATAACAATATTTGCTAGG - Intronic
1018217519 6:161544274-161544296 CCAAAATAACACTATGTTCAGGG - Intronic
1020101804 7:5397955-5397977 CCCAAATAGAAGTATGTCCTGGG - Intronic
1021790064 7:24195882-24195904 CCCAAACTTCTCTATGTGGTAGG + Intergenic
1021910623 7:25382685-25382707 CCCAAAATTCCCTATGTTCTAGG + Intergenic
1022954543 7:35369094-35369116 CCAAGATCTCACTATATGCTAGG - Intergenic
1024181227 7:46897294-46897316 CCCACATATGACTCTGGGCTAGG - Intergenic
1025204329 7:56983135-56983157 CTCAAAGAGCAGTATGTGCTGGG + Intergenic
1025667610 7:63593799-63593821 CTCAAAGAGCAGTATGTGCTGGG - Intergenic
1027154458 7:75756667-75756689 CCCAAATTCCAATATGTTCTGGG - Intergenic
1031661248 7:124427685-124427707 CCGAACTATTAATATGTGCTTGG + Intergenic
1031793575 7:126141686-126141708 ACCAGATATCATTAAGTGCTAGG + Intergenic
1031956687 7:127949745-127949767 CCCACATTTCACCCTGTGCTGGG - Intronic
1033972097 7:147055128-147055150 CCCAAATAATAATATTTGCTAGG + Intronic
1036709090 8:11066902-11066924 CCCACATATCCCTCAGTGCTGGG - Intronic
1040843579 8:51810657-51810679 CCCAACAATCACTATGCTCTTGG + Intergenic
1040978676 8:53222180-53222202 CTTGGATATCACTATGTGCTAGG - Intergenic
1049637781 8:143698378-143698400 CCCAAATATCTTTATTTACTTGG - Intronic
1049984769 9:939310-939332 CCCAAATTGCACCATATGCTGGG + Intronic
1051570071 9:18545990-18546012 CCAAGACATCACTTTGTGCTGGG + Intronic
1055603734 9:77947077-77947099 CCCAAATATCCTTCTCTGCTGGG + Intronic
1056436971 9:86583877-86583899 CCCAGATATCTCCATGGGCTGGG + Intergenic
1058662270 9:107277482-107277504 CCAAGATATCACTAGGTGATAGG - Intergenic
1060004791 9:119990320-119990342 CCCAAATGTCATTATGTAATAGG - Intergenic
1060898268 9:127233684-127233706 CCCAAATATTGCTCTGTGCATGG + Intronic
1185669037 X:1791175-1791197 TCCCAATATCTCTGTGTGCTTGG + Intergenic
1186557170 X:10572047-10572069 CCCATGTACCACTATCTGCTTGG - Intronic
1186896904 X:14012783-14012805 CTCAAATCTCACTAGGTGCTGGG + Intronic
1189831152 X:44974546-44974568 CTGAAATATCACTATCTACTGGG + Intronic
1193554643 X:82938025-82938047 CCTAATTATCACTATTTTCTAGG + Intergenic
1195322777 X:103733775-103733797 GCCAACTATAACTATGTGATTGG - Intergenic
1200848892 Y:7861995-7862017 CCAAAATATCTCTATTGGCTGGG + Intergenic
1202263389 Y:22993137-22993159 CCCAATTTTCTCCATGTGCTAGG - Intronic
1202416379 Y:24626878-24626900 CCCAATTTTCTCCATGTGCTAGG - Intronic
1202454408 Y:25043208-25043230 CCCAATTTTCTCCATGTGCTAGG + Intronic