ID: 960293890

View in Genome Browser
Species Human (GRCh38)
Location 3:115919079-115919101
Sequence TGCTGTGTGGTCTGCCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960293890 Original CRISPR TGCTGTGTGGTCTGCCCTAC AGG (reversed) Intronic
903123772 1:21233960-21233982 TGCTTAGTAGTCTGCCATACTGG - Intronic
903174517 1:21572966-21572988 TGCTGTGTGCTGAGCCCTGCAGG + Intronic
905609067 1:39332923-39332945 TGCTGTTTGGTCTTCCCTTTGGG - Intronic
905909907 1:41646581-41646603 TGCAGAGTGGTCTGGCCAACGGG + Intronic
907158807 1:52356918-52356940 GGCTGTGTGGTCTGAGCTCCAGG + Intronic
911980254 1:104558138-104558160 TGCAGTGGGGTCTGCCCTCAAGG - Intergenic
915575918 1:156776821-156776843 TTCTGTGTGGTCTGCCAGAAAGG + Intronic
921312229 1:213855793-213855815 TTCTGTGTGGTCTGCCTTGCAGG + Intergenic
922784605 1:228276730-228276752 TGCTCTGTGCTGTGCCCTGCCGG - Intronic
1069514958 10:69070119-69070141 TGCTATGGGGTCAGCCCTCCTGG + Intergenic
1073486828 10:103824436-103824458 TGCTGTGTGGCTTCCCCTCCGGG - Intronic
1074741402 10:116487768-116487790 TTCTGTGAGTTCTGCCCTATGGG + Intergenic
1084751918 11:71209629-71209651 TGCTGTGTGTTCTGCCACAAGGG - Intronic
1085284544 11:75351426-75351448 TCCTGTGTGGTCTCCCCGGCAGG - Intronic
1088902265 11:114127200-114127222 TCCTGTGTGATGTGCCCTCCTGG + Intronic
1090382484 11:126337012-126337034 TGCAGTGTGTTCAGCCCTCCAGG + Intronic
1091080586 11:132663751-132663773 TGCTGTAAGGCCTGCCCTTCTGG - Intronic
1093487393 12:19666320-19666342 AGCTTTGAGGTCTGCCCTGCTGG + Intronic
1094665659 12:32518200-32518222 TGAAGGGTGGTGTGCCCTACAGG + Intronic
1099602430 12:84758220-84758242 TGCTGGATGGCATGCCCTACAGG - Intergenic
1101924322 12:108958641-108958663 TGCTACTTGGTCTGCCCTTCAGG + Intronic
1102033978 12:109760536-109760558 TGGTGTGTGGTTGGCCCTGCTGG + Intronic
1102767188 12:115443611-115443633 TGCTCTGTGGACTTCCCTTCAGG - Intergenic
1104964224 12:132501753-132501775 TGCTGTGTGGCCAGCGCTGCTGG - Intronic
1106178823 13:27353682-27353704 TGCTGTCTGGTCTCTCCTAAAGG + Intergenic
1115966725 14:38898280-38898302 TGCTATGTGGACTGCCTTGCAGG - Intergenic
1122005474 14:98699885-98699907 TGCTTTGAGGGCTGCCCTAGAGG - Intergenic
1122340703 14:101026596-101026618 TGATGTGGGGTCTGCTCCACTGG + Intergenic
1122722645 14:103730739-103730761 GAGTGTGTGGCCTGCCCTACAGG - Intronic
1122769570 14:104092015-104092037 TGCTGTGTGCTAGGCCCTCCAGG + Intronic
1122787003 14:104168475-104168497 AGCTGTCAGGTCTGCCCCACAGG - Intronic
1123783301 15:23646604-23646626 TGCTGCGTGGCCTGCCATCCTGG + Exonic
1124329543 15:28797806-28797828 TCCAGTGTGGTCAGCTCTACTGG - Intergenic
1125283528 15:38069066-38069088 TGCTCTGTGGTGTGCCCTGCAGG - Intergenic
1126777893 15:52114833-52114855 TGCTGTGGTGTCTGCTCAACGGG + Intergenic
1132832064 16:1933268-1933290 TGCTGTGTGCACTGCCCTGTGGG - Intergenic
1133283897 16:4681741-4681763 TGCTCTGCGGCCTGCCCTTCTGG - Exonic
1134814025 16:17191264-17191286 TGCTGTGCGGTCTTAACTACAGG + Intronic
1136094617 16:27946004-27946026 TGCTGTGTGTTCTGACCTGGCGG - Intronic
1144754125 17:17669223-17669245 TGCTCTGTGGTCTGCACTGGAGG - Intergenic
1146299934 17:31679919-31679941 TGTTGTGGGGTCTGCCTCACAGG - Intergenic
1151746354 17:76013888-76013910 GCCTGTGTGGTCTGCCCATCTGG + Intronic
1152539233 17:80966606-80966628 TGATGTGGGGTCTGCGCCACAGG - Intergenic
1153521793 18:5960976-5960998 AACTGAGTGGTCTGCACTACTGG + Intronic
1154961705 18:21315975-21315997 TGCTGTGCAGTCTGCCCTCGGGG + Intronic
1155600478 18:27540324-27540346 CTCTGTGTGGAATGCCCTACGGG - Intergenic
1160185793 18:76675254-76675276 TGCTGTGTGGGCTGTTCTGCCGG - Intergenic
1160245727 18:77157945-77157967 TGCTTTGTGGTCTGCTTTGCAGG + Intergenic
1160386468 18:78499956-78499978 TGCTGTGTGGTGTACCCCAGAGG - Intergenic
1164740539 19:30572416-30572438 TGCTGTGTGGACGGCCATTCTGG + Intronic
1165858230 19:38893072-38893094 TGCTGTTTGGTTTGAACTACTGG + Intronic
1168131770 19:54325796-54325818 TGCTGTATGGTTTGACCTCCAGG + Intergenic
1168681321 19:58318083-58318105 TGCTGGGTGGCCTGACCTGCAGG + Intergenic
926000836 2:9331126-9331148 TGCTGGGTGCTGTGCCCTGCTGG + Intronic
930549515 2:52814944-52814966 GGCTGTGTGGTTTGATCTACAGG + Intergenic
933750235 2:85598602-85598624 TGCTGTGTTATTTGCCCTAAAGG + Exonic
933829017 2:86191540-86191562 TGCTGTGTGGTTTGGCAGACTGG - Intronic
934761007 2:96857247-96857269 TGCTGTGTCATCTGCCCTTGCGG - Intronic
935640954 2:105289607-105289629 TGCTATGTGTTAAGCCCTACAGG + Intronic
937350787 2:121159597-121159619 TGCTCTGTGGACTGCCCAGCTGG - Intergenic
938187223 2:129242608-129242630 AGCTGTGTCCTCTGCCCTGCAGG - Intergenic
942519449 2:176788042-176788064 TGCTGAGTGGACAGCCCTGCTGG + Intergenic
945432156 2:209777102-209777124 TGCTTTTTGGACTTCCCTACTGG - Intronic
948179250 2:235966690-235966712 TGCTGCCTGGGCTGCCCTGCAGG + Intronic
948567101 2:238894232-238894254 TGCTGAGTGAACTGCCCTTCAGG + Intronic
1168851187 20:978146-978168 TGCTGAATGTTCTGCCCTGCTGG - Intronic
1170188287 20:13617538-13617560 TCCAGTGTGGTCAGCTCTACTGG + Intronic
1170304366 20:14921588-14921610 TGCTGTGATGTCTGCCCAGCTGG + Intronic
1175575706 20:60058947-60058969 TGCTGTGAGGTCTCCTCTTCCGG + Exonic
1175891035 20:62316041-62316063 CGCAGTGTGGGCTGCCCTCCAGG - Exonic
1176089722 20:63313469-63313491 TGCTGCCTGGGCTGCCCTGCGGG - Intronic
1176288599 21:5032739-5032761 CGCTGCGAGGTCTGCCCTGCAGG + Intronic
1179868585 21:44230736-44230758 CGCTGCGAGGTCTGCCCTGCAGG - Intronic
1182270812 22:29152211-29152233 TGCTGAATGGTCTGCACTGCAGG + Intronic
1182890808 22:33817467-33817489 GGTTGTGGGGTCTGCCCCACGGG - Intronic
1183287642 22:36977444-36977466 GGCTGTGGGGTGTGCCCTAGAGG + Intergenic
1184850824 22:47119285-47119307 TGCTGTGTGACCTGCCCCGCTGG + Intronic
1184852811 22:47130383-47130405 TGCTGAGGGGTGTGCTCTACCGG - Intronic
950430862 3:12950198-12950220 TGCTCTGTGGTCTGCAGTCCTGG - Intronic
954248335 3:49349248-49349270 TGCTTTGTGGTCTCCTCTACTGG + Intergenic
955376278 3:58399973-58399995 TGCTGTGGGGCCTTCCCTTCAGG + Intronic
955793438 3:62611029-62611051 TGCTGTGGGGACTGCCCTGTAGG - Intronic
960293890 3:115919079-115919101 TGCTGTGTGGTCTGCCCTACAGG - Intronic
960409117 3:117300310-117300332 TGCTATTTGGACTGCCCTAGAGG - Intergenic
962836131 3:139190248-139190270 TGCTTGGGGGTCTGCCCAACAGG - Intronic
967946026 3:194804950-194804972 TGCTGAGTGGTCTGCACCCCAGG - Intergenic
968419227 4:468633-468655 TGCTGTGTGGCCTGCCTTTGAGG - Intronic
968588734 4:1447020-1447042 TGCTGTGTGGGGTGCGCTGCAGG + Intergenic
969503653 4:7570434-7570456 CGCTGGGTGCTCTGCCCTGCAGG + Intronic
977251490 4:94693882-94693904 TCCTGTCAGGTCTGCCCTGCAGG + Intergenic
981076217 4:140595124-140595146 GGCTGTGTGGTTTGCCCTACAGG + Intergenic
983286231 4:165742957-165742979 TGCTGTGTGGTTTACACTAGAGG + Intergenic
984470468 4:180165044-180165066 TGCTATTTGCTCTGCTCTACTGG + Intergenic
985563229 5:602382-602404 TTCTGTGTGGCCTTCGCTACCGG - Intergenic
989143981 5:38229740-38229762 TGCTGTGTGATCATCACTACTGG + Intergenic
990349003 5:54897272-54897294 TGATGTGGGGTCTGCATTACAGG - Intergenic
990353803 5:54945419-54945441 TGCTGTGTGAACTGCCTTGCTGG - Intergenic
995811685 5:116114412-116114434 GGCTGTGTGGGCTGACCTCCAGG + Intronic
996638993 5:125730161-125730183 GGCTCTGTGGTTTGCCCTAGTGG - Intergenic
997843673 5:137265873-137265895 TGCTGTGGTGCCTACCCTACAGG - Intronic
1007337469 6:41163759-41163781 TGCTGTGTGTCAGGCCCTACTGG - Intergenic
1007593345 6:43036716-43036738 TGCAGTGTGCTCTGCCATTCGGG - Intergenic
1010120489 6:72370131-72370153 TGCTGTGTTCCCTGCCCCACTGG - Intronic
1011250170 6:85363060-85363082 TGCTGTGTGATCTGTCCAAAAGG - Intergenic
1011911896 6:92450402-92450424 TGCTATGTGGGCTGGCCTCCAGG - Intergenic
1014525478 6:122496184-122496206 TGCCATGTGGTTTGACCTACAGG - Intronic
1014986239 6:128013802-128013824 TGCTGTGTGATCTGCCTGAGAGG - Intronic
1019640528 7:2101219-2101241 TGCTATGGGGTCTGCCCTGGGGG + Intronic
1021198586 7:17699696-17699718 AGATATGTGGTCTGCCCAACAGG + Intergenic
1022507313 7:30915177-30915199 TGCTGTCTGGTCTGCTCAGCCGG + Intronic
1024550639 7:50560058-50560080 TGCTCTGTGGTCAGCCATCCAGG + Intronic
1027715145 7:81659941-81659963 GGCTGTGTGGTTTAACCTACAGG - Intergenic
1028879799 7:95867504-95867526 TGCTGTATGGTCTCACCTGCTGG + Intronic
1031263196 7:119549051-119549073 AGCTGTGTAGTCTGCTCTCCAGG - Intergenic
1035170584 7:157015246-157015268 TGCTGTGTGCTCCGCTCTATGGG + Intergenic
1037811847 8:22091051-22091073 GGCGGTGTGGTTGGCCCTACAGG + Intronic
1037970172 8:23165984-23166006 TACTGTGTGGTCCACCCTCCAGG - Intergenic
1045491068 8:102669762-102669784 TGCTGTGTGGAATGTGCTACAGG - Intergenic
1047630231 8:126699162-126699184 GGCTGTGTGGTGTAACCTACAGG - Intergenic
1049617653 8:143582672-143582694 TGCTGTGGGCTCTGGCCTAGTGG - Intronic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1051878663 9:21817543-21817565 TGCCGTGTGGCCTGCTCCACAGG + Intronic
1052553609 9:29985056-29985078 TGTCCTGTGGTCTGCCATACAGG - Intergenic
1059449296 9:114360225-114360247 GGCTGTGTGGTCTTCGATACTGG + Intronic
1059627583 9:116083932-116083954 TTCTGTGTGGTCTCTCCTGCAGG + Intergenic
1060855210 9:126909566-126909588 TGCTGCGTGGTCTTCTCTATAGG + Intergenic
1062288705 9:135785174-135785196 TGCTGTGTGGACTGCAGCACAGG - Intronic
1185774939 X:2794513-2794535 TGCCGCGTGCTCTGCCCCACAGG + Exonic
1186473786 X:9841587-9841609 TGCTGTGGGGTCTGACCTGCAGG - Intronic
1193080179 X:77398989-77399011 TGCAGTGTGGTCTGACCTCCTGG - Intergenic
1199620048 X:149691806-149691828 TGCTGTGTACTCTGCCCTCCAGG + Intronic
1200187753 X:154193909-154193931 TGCCGTGTGCTCTTCCCTTCCGG + Intergenic
1201144098 Y:11053282-11053304 TGCTGTGTGTACTGCCTTTCTGG - Intergenic