ID: 960294359

View in Genome Browser
Species Human (GRCh38)
Location 3:115925073-115925095
Sequence GTGGACTTGGAAGGAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 203}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960294359_960294365 -8 Left 960294359 3:115925073-115925095 CCTGGGTTTCCTTCCAAGTCCAC 0: 1
1: 0
2: 3
3: 26
4: 203
Right 960294365 3:115925088-115925110 AAGTCCACTCTTTGAGGGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 107
960294359_960294375 30 Left 960294359 3:115925073-115925095 CCTGGGTTTCCTTCCAAGTCCAC 0: 1
1: 0
2: 3
3: 26
4: 203
Right 960294375 3:115925126-115925148 GTGTGTGTTCCTAGGCCTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 256
960294359_960294371 22 Left 960294359 3:115925073-115925095 CCTGGGTTTCCTTCCAAGTCCAC 0: 1
1: 0
2: 3
3: 26
4: 203
Right 960294371 3:115925118-115925140 CCAGGTATGTGTGTGTTCCTAGG 0: 1
1: 0
2: 0
3: 33
4: 266
960294359_960294373 28 Left 960294359 3:115925073-115925095 CCTGGGTTTCCTTCCAAGTCCAC 0: 1
1: 0
2: 3
3: 26
4: 203
Right 960294373 3:115925124-115925146 ATGTGTGTGTTCCTAGGCCTGGG 0: 1
1: 0
2: 3
3: 14
4: 193
960294359_960294374 29 Left 960294359 3:115925073-115925095 CCTGGGTTTCCTTCCAAGTCCAC 0: 1
1: 0
2: 3
3: 26
4: 203
Right 960294374 3:115925125-115925147 TGTGTGTGTTCCTAGGCCTGGGG 0: 1
1: 0
2: 3
3: 34
4: 337
960294359_960294372 27 Left 960294359 3:115925073-115925095 CCTGGGTTTCCTTCCAAGTCCAC 0: 1
1: 0
2: 3
3: 26
4: 203
Right 960294372 3:115925123-115925145 TATGTGTGTGTTCCTAGGCCTGG 0: 1
1: 0
2: 3
3: 20
4: 258
960294359_960294367 4 Left 960294359 3:115925073-115925095 CCTGGGTTTCCTTCCAAGTCCAC 0: 1
1: 0
2: 3
3: 26
4: 203
Right 960294367 3:115925100-115925122 TGAGGGGTAGGCCATATCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960294359 Original CRISPR GTGGACTTGGAAGGAAACCC AGG (reversed) Intronic
900811502 1:4805090-4805112 GTCCACTGGGAAAGAAACCCAGG + Intergenic
901158974 1:7160524-7160546 AGGGAGTTGGAAGGAAAGCCAGG - Intronic
901281160 1:8036253-8036275 GTGGACAGGGAAGGCAACCTTGG + Intergenic
903137616 1:21319620-21319642 GTGAACTGGGCAGGAAAGCCAGG + Intronic
903607464 1:24585308-24585330 GTGCACAAGAAAGGAAACCCGGG - Intronic
903643300 1:24875074-24875096 TGCGGCTTGGAAGGAAACCCTGG - Intergenic
904591760 1:31618898-31618920 GTGGAATTGGGATGCAACCCAGG + Intronic
906560768 1:46755217-46755239 GTGGACTGGGAAGGTTTCCCAGG + Intergenic
912723718 1:112041307-112041329 GGGGACTTGAAAGAAAGCCCTGG - Intergenic
915196165 1:154191525-154191547 GGGGTCTTGGATGAAAACCCAGG - Intronic
916910200 1:169337841-169337863 TTGGTCTTTGAAGGAAGCCCTGG - Intronic
917300648 1:173570642-173570664 GTGAACTTGGAAGGCAGCCTAGG - Intronic
917838152 1:178957084-178957106 GTGGAGGTGGCAGGAAACCCAGG + Intergenic
921006171 1:211095601-211095623 GAGTACTTGGGAGGAAGCCCAGG - Intronic
922507086 1:226132896-226132918 GTGGAACTGGAAGGAGACCCGGG - Intergenic
922750311 1:228067153-228067175 GTGCTGTTGGAAGGAGACCCAGG - Intergenic
923678398 1:236099808-236099830 GTGGATCTGGAAGGCAACTCGGG + Intergenic
1064237106 10:13586788-13586810 GTGAACGTGGACGGAAACCCGGG - Intergenic
1066733764 10:38454108-38454130 GTCGCCTTGGAAGGCATCCCTGG + Intergenic
1067023130 10:42819485-42819507 CTGGATATGGGAGGAAACCCTGG + Intronic
1067270861 10:44790254-44790276 GGTGACTGGGAAGGAAGCCCAGG + Intergenic
1070558500 10:77548153-77548175 GTGGATTTGGAAGGAAACTCAGG - Intronic
1070643739 10:78187076-78187098 TTGGACATGGCAGAAAACCCAGG - Intergenic
1071056620 10:81519128-81519150 GGGGACTTGGAAGGAAAAGGTGG + Intergenic
1073077236 10:100831794-100831816 GTGGACCTGGAGGCAAAGCCAGG - Intergenic
1073195074 10:101683831-101683853 GCTGATTTGGAAGGAAACTCAGG + Intronic
1073937382 10:108649800-108649822 GTGGACATGGAAAGAAATCTGGG + Intergenic
1073942024 10:108710471-108710493 GTGGACTGTGCAGGAAACACAGG - Intergenic
1074406978 10:113188139-113188161 ATCTACTTGGAAAGAAACCCAGG - Intergenic
1074872331 10:117587107-117587129 TTGGACTTGGAAGGAAGCAGTGG - Intergenic
1075025298 10:118979598-118979620 TTGAACTTAGAAGCAAACCCAGG - Intergenic
1075562756 10:123480386-123480408 GTGGATTTGGAAAGAGATCCGGG + Intergenic
1076248192 10:128964047-128964069 TTGGCATTGGAAGGAAGCCCTGG + Intergenic
1079613521 11:22462567-22462589 TTGGACTTGGGAAGAAACCATGG - Intergenic
1081878310 11:46426220-46426242 GTGGACATGCAGAGAAACCCAGG + Intronic
1084431496 11:69113947-69113969 ATGGAGGTGGAAGGAGACCCAGG - Intergenic
1084788607 11:71458866-71458888 GTGGACATGGAATGAGCCCCAGG - Intronic
1084968371 11:72756140-72756162 GAGGACTTGGAAGGACAGGCAGG - Intronic
1087088735 11:94246163-94246185 GAGGACTGCTAAGGAAACCCAGG + Intergenic
1087744241 11:101925036-101925058 GGGGACTTGGAGGGAAACAAAGG - Intronic
1088619119 11:111664020-111664042 GAGGAAGTAGAAGGAAACCCTGG + Intronic
1090183572 11:124721392-124721414 GTGAACTTGGAAGAGAACCTTGG - Intergenic
1090956306 11:131515645-131515667 CTGGCCTTGGAAGCCAACCCTGG + Intronic
1092206319 12:6616196-6616218 GAGGAGAAGGAAGGAAACCCGGG + Intergenic
1093240271 12:16661822-16661844 GGGGAGTTGGAAGGAATACCTGG + Intergenic
1093728492 12:22542573-22542595 GTGGGCCTTGAAGGACACCCAGG - Intronic
1095616696 12:44198729-44198751 GTGTACTTGGAGTGAAACCAGGG + Intronic
1097868908 12:64583705-64583727 GAGGAGTTGGATGGAAACCGAGG - Intergenic
1099257046 12:80327326-80327348 CTGGACTTGGTAAGAATCCCTGG - Intronic
1099687135 12:85904800-85904822 GGGGACTTGGAGGGAAAGGCGGG - Intergenic
1100878987 12:98995517-98995539 GCAGAATTGGAATGAAACCCAGG + Intronic
1101792044 12:107936243-107936265 ATGGACTTGGAAGGGGACCCTGG + Intergenic
1103003755 12:117405928-117405950 GGGGACATGGAAGGAAAGGCTGG - Intronic
1103724325 12:122990190-122990212 GGGGACTGAGAAGGGAACCCGGG + Intronic
1104262833 12:127200353-127200375 CTTGACTTGGAAAGATACCCAGG + Intergenic
1105004025 12:132710236-132710258 GTCCCCCTGGAAGGAAACCCAGG + Intergenic
1105042684 12:132973034-132973056 ATTGACTTTGAAGGAAATCCGGG - Intergenic
1107237745 13:38193258-38193280 GTGGACTGGGAAGGATTCCAGGG + Intergenic
1112435769 13:99390291-99390313 GTGGGTTTGGAAGAAAACTCTGG - Intergenic
1113955054 13:114095811-114095833 GTGGAGTTGGAAAGAGACCCAGG - Intronic
1115999525 14:39228084-39228106 GTTGTCTTGGAAGGCAACACTGG - Intergenic
1119615223 14:76094507-76094529 TTGGACTTAGAAGGAAAATCAGG + Intergenic
1121566588 14:94914625-94914647 TTGGAGCTGGAATGAAACCCAGG + Intergenic
1122238527 14:100346387-100346409 GTGGCCTTGGATGGAACCCAGGG - Intronic
1122363981 14:101183501-101183523 GTGGGCTTGGAGAGAAACCCTGG + Intergenic
1123046314 14:105518143-105518165 CAGGACCTGGAATGAAACCCTGG + Intergenic
1123424279 15:20156665-20156687 CTGGATATGGGAGGAAACCCTGG + Intergenic
1123533501 15:21163194-21163216 CTGGATATGGGAGGAAACCCTGG + Intergenic
1123682299 15:22771458-22771480 GTGGCATTGGAAGGGACCCCAGG + Intergenic
1123996237 15:25719700-25719722 GGGGACATGGAAGGCATCCCAGG - Intronic
1125593674 15:40871490-40871512 AGGGACTTTGAAGGACACCCAGG - Intergenic
1126671969 15:51124640-51124662 TTTGTCCTGGAAGGAAACCCTGG + Intergenic
1127480438 15:59372438-59372460 GGGGACGGGGCAGGAAACCCCGG - Intronic
1128501145 15:68228640-68228662 GAGGACTTGGTAGGGGACCCAGG - Intronic
1128612039 15:69081802-69081824 CAGGACTTGGCAGGAAACCCTGG - Intergenic
1128726592 15:69992437-69992459 GTGGAGTCGGATGCAAACCCTGG - Intergenic
1129520459 15:76182847-76182869 AGGGACTAGGAAAGAAACCCAGG + Intronic
1129526287 15:76217260-76217282 GTGGACTTGGAAGGAAAGTCAGG - Intronic
1131268414 15:90932361-90932383 GGGGACTGGGAAGGAAACGTGGG - Intronic
1131784641 15:95898869-95898891 GTTGATTTGTAAGGAAAACCCGG - Intergenic
1132389042 15:101425341-101425363 GTGGGCTTGGAGGGAGAACCAGG - Intronic
1133046418 16:3090721-3090743 CTGGAAGTGGAAAGAAACCCAGG + Intronic
1133902155 16:9986963-9986985 GTGGTGCTGGAAGGAAACTCGGG - Intronic
1134135330 16:11673392-11673414 GTGGCCTTGGCATGCAACCCTGG - Intronic
1135772634 16:25228917-25228939 GAGCACGTGGAAGGAAACACTGG - Exonic
1136860585 16:33699222-33699244 CTGGATATGGGAGGAAACCCTGG - Intergenic
1137776411 16:51058396-51058418 GTTGATTTGGGAGGAATCCCAGG + Intergenic
1137983804 16:53091170-53091192 GTGTTCTTGGAAGGAAGCCTGGG + Intronic
1138912306 16:61416147-61416169 TTGGAATTGGAAAGAGACCCAGG + Intergenic
1140044125 16:71429182-71429204 GTAGAAGTGGAAGGAGACCCTGG + Intergenic
1140905546 16:79406197-79406219 ATTGACTTGGAAGGAGATCCTGG - Intergenic
1142008733 16:87702763-87702785 GCCGACTTGGAAGGAAACACAGG - Intronic
1203122085 16_KI270728v1_random:1547405-1547427 CTGGATATGGGAGGAAACCCTGG - Intergenic
1145909966 17:28536788-28536810 GTGCACTTGGGAGTGAACCCTGG - Intronic
1146198265 17:30831839-30831861 GTGGAATTGAAAGCCAACCCGGG - Intergenic
1147713143 17:42484666-42484688 GTGTACATGGAAGGAAAGGCTGG + Intronic
1148839479 17:50485546-50485568 GTGGACTTTAAAGCAAATCCTGG + Exonic
1149664822 17:58358129-58358151 GTGGACATGGCTGGAAACCTGGG + Exonic
1150755797 17:67911701-67911723 ATGGACTTTGAAGGAAAACTGGG + Exonic
1152299003 17:79484622-79484644 GTGGAGGTGGAAGGCAGCCCAGG + Intronic
1152356105 17:79808300-79808322 GTGGATTGGGAATGAAATCCAGG + Intergenic
1156182968 18:34627425-34627447 GTGGACTGGGAAGGAACCATGGG - Intronic
1157138770 18:45084755-45084777 GTGGAATTGGGATGAAACCAGGG + Intergenic
1157560134 18:48639866-48639888 GTTTCCTGGGAAGGAAACCCAGG - Intronic
1166668859 19:44698027-44698049 GTGCCCTTGGGAGGAAGCCCAGG - Intergenic
1166774643 19:45304955-45304977 GTGCCCTTGGAAGAAAGCCCAGG - Intronic
1167201163 19:48066523-48066545 GTGGCCTGGGAAGGGAACCCTGG - Intronic
1167615247 19:50529493-50529515 GTGGACTTTAAAAGAAAGCCTGG + Intronic
924997134 2:372479-372501 GTGGACTTGGACTGGAACCCTGG + Intergenic
926775718 2:16420582-16420604 GTAGACTTGGCAGGAAGCTCTGG + Intergenic
926956040 2:18301435-18301457 TTGGACTTGAAAGGAAAAACTGG + Intronic
927172385 2:20381024-20381046 GTGTGCTTGGAAGGAACCCCTGG + Intergenic
927465723 2:23334952-23334974 GTGGACTTGGACCGAGACCAAGG + Intergenic
928849986 2:35734221-35734243 GTGGACATGCAGGGAAACCCAGG + Intergenic
930892226 2:56403788-56403810 GTGGAATTGGAATGCAACACAGG - Intergenic
934458965 2:94200374-94200396 CTGGATATGGGAGGAAACCCTGG - Intergenic
934851069 2:97701537-97701559 GTGGCCTTGAGAGGCAACCCTGG - Intergenic
936107867 2:109640878-109640900 GTCGATTTGGAAGGAAAGGCTGG - Intergenic
936998634 2:118441189-118441211 AAGGACTTGGGAAGAAACCCAGG - Intergenic
939164474 2:138625678-138625700 GTGGACTTGGAAGCAAATTCTGG - Intergenic
942681543 2:178481754-178481776 CTGGAGTTGGAAGGCATCCCGGG - Intronic
943067633 2:183105569-183105591 TGGGACTTGGGTGGAAACCCAGG - Intergenic
944415985 2:199480254-199480276 CTGGACTCTGAAGGAAAGCCTGG - Intergenic
946401639 2:219471657-219471679 GTAGACTTGGAAGCCAGCCCGGG + Intronic
947153485 2:227137267-227137289 GGGTACGTGCAAGGAAACCCAGG + Intronic
947654983 2:231819343-231819365 GTGGATGAGGAAGGAAACCCAGG - Intergenic
948734930 2:239996590-239996612 GTGGTCTGGGAAGGAAGCCCTGG - Intronic
1169426376 20:5500611-5500633 CTGGACTTGGAGAGAAACCTGGG - Intergenic
1169792292 20:9424348-9424370 GTGGATTTGGAAGAAAATTCAGG - Intronic
1170029884 20:11933539-11933561 ATGGCCCTGGAAGGAAGCCCTGG + Intergenic
1171157677 20:22891192-22891214 GGTGAATTGGAAGGAGACCCGGG + Intergenic
1171218766 20:23374298-23374320 GAGGGTTTAGAAGGAAACCCTGG - Intergenic
1171346238 20:24468888-24468910 TTGGAATTGGAAGGAAACTAGGG - Intergenic
1172499012 20:35411848-35411870 GAGGAATTGGAAGGAATCGCAGG - Intronic
1172902239 20:38343843-38343865 GTGGAATTGGATGGACAGCCTGG + Intergenic
1174172344 20:48625482-48625504 GTGGACGTTGAAGGAAACCGGGG + Exonic
1174346934 20:49936893-49936915 GTGGACTAGAAAGGAAACGTCGG - Intronic
1174361822 20:50033708-50033730 ATCCACTTGGAAGGATACCCAGG + Intergenic
1174742058 20:53024462-53024484 GTGCACATGGTAGGAAACCATGG - Intronic
1175155402 20:56967949-56967971 GTGGGCGTGGAAGGATGCCCTGG - Intergenic
1175995968 20:62812543-62812565 GTGGAGGAGGAAGGAAGCCCCGG + Exonic
1176428474 21:6562638-6562660 GTGGTCTTAGAAAGAACCCCAGG + Intergenic
1177180245 21:17736987-17737009 GTGCACTAAGAAGGAAAACCAGG - Intergenic
1178788049 21:35672631-35672653 GTGGGCTTGGAAGAGGACCCTGG + Intronic
1179510505 21:41869931-41869953 GTGGACTAGAAGGGAGACCCAGG - Intronic
1179703964 21:43170954-43170976 GTGGTCTTAGAAAGAACCCCAGG + Intronic
1180141760 21:45897541-45897563 GTGGTCATGGAAGGAAAAGCCGG - Intronic
1181357248 22:22306090-22306112 CTGGATATGGGAGGAAACCCTGG + Intergenic
1184252360 22:43268028-43268050 GTGAGCTTGGAAGGACCCCCCGG + Intronic
1184314532 22:43674474-43674496 GAGGAACTGGAAGGAATCCCAGG + Intronic
1184803386 22:46776160-46776182 GTGGACTTTGAAGGTTACCTGGG + Intronic
1184938002 22:47739273-47739295 GTGGTTCTGGAAGGAAACCAGGG + Intergenic
1185179208 22:49349584-49349606 ATGGATTTGGAAGAAAACCCAGG - Intergenic
950649159 3:14396478-14396500 CTGGAGTTGGAGGGAAAGCCAGG + Intergenic
950888570 3:16382598-16382620 CTGAACTTGCAAGGAAAGCCAGG - Intronic
950969708 3:17174090-17174112 GTGGACTTTGAAGAAAAGGCAGG - Intronic
951395941 3:22166464-22166486 TTGAACTTGCAATGAAACCCTGG - Intronic
952450466 3:33427604-33427626 GTGAAATGGGACGGAAACCCTGG + Intronic
953476491 3:43209848-43209870 ATGGACCTGGAAGAAAACTCTGG - Intergenic
953625205 3:44565358-44565380 GTGGGGCTGGAAGGACACCCTGG + Intronic
953837128 3:46356486-46356508 GTGGAATTGGAATAAAACCAGGG + Intronic
959123229 3:102257845-102257867 GTGCACGTTGTAGGAAACCCAGG + Intronic
960294359 3:115925073-115925095 GTGGACTTGGAAGGAAACCCAGG - Intronic
961536349 3:127573258-127573280 ATGGCCCTGGAAGGAAAGCCTGG + Exonic
962778641 3:138689303-138689325 CTGGACTTAGAAGGAAATGCTGG + Intronic
964205646 3:154171911-154171933 GTGGGAGTAGAAGGAAACCCCGG + Intronic
965384728 3:168032471-168032493 GTGTACTGGGATGGAAAACCTGG - Intronic
966242388 3:177768942-177768964 ATGGTTTTGGGAGGAAACCCAGG - Intergenic
966584412 3:181605381-181605403 ATGGACTTTGGAGGAAACCATGG - Intergenic
967040506 3:185687996-185688018 GTGAACTTGGAGGAAAAGCCAGG + Intronic
968744666 4:2353476-2353498 GTGTACTGGGAAGAAAACCTCGG + Intronic
969398875 4:6940441-6940463 GGGGAAGGGGAAGGAAACCCAGG + Intronic
970161920 4:13197590-13197612 GTGGACCTAGGAAGAAACCCAGG - Intergenic
971814052 4:31464544-31464566 GTGGCCTTGGAATGAAAATCAGG - Intergenic
972390378 4:38607738-38607760 TTGGGCCTGGATGGAAACCCTGG - Intergenic
976574925 4:86657962-86657984 GTGGACTTGGAATGCAACCCAGG - Intronic
976828314 4:89284622-89284644 GTGGACTTGGAAGGTAGACCTGG - Intronic
977173849 4:93795971-93795993 GTGAACTTGGAAGAGAACTCCGG - Intergenic
982531093 4:156544987-156545009 GGGGATTAGGAAGGAAACACAGG - Intergenic
985625488 5:983124-983146 CTGGACTAGGAGGAAAACCCTGG - Intergenic
986454091 5:7898483-7898505 GAGGGCTCAGAAGGAAACCCTGG + Intronic
990282495 5:54266431-54266453 GAAGACTTGGAACCAAACCCAGG - Intronic
991356612 5:65775493-65775515 GGGGACTTGGGAGGAATCCCTGG - Intronic
991608709 5:68428714-68428736 GTGGGTTTGGAAGGGAACCTGGG + Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
993667861 5:90722949-90722971 GGGGACCTGGTAGGAAACTCAGG + Intronic
999482375 5:151960480-151960502 GTAGAGTGGGAAGGAAACCCTGG - Intergenic
1001048026 5:168390616-168390638 CTTGACTTGGAAGGCAAACCTGG - Intronic
1001955502 5:175845846-175845868 CAGGACTTTGAGGGAAACCCAGG + Intronic
1004895967 6:20148055-20148077 GTGGCTTGGGAAGGAAACACAGG + Intronic
1006574141 6:35031562-35031584 GAGATTTTGGAAGGAAACCCTGG - Intronic
1007401657 6:41606028-41606050 GTGGACTGGGCAGGACACCTGGG + Intergenic
1007512209 6:42382187-42382209 TTGGACATGGAAGGCCACCCAGG + Intronic
1008725469 6:54412645-54412667 CTGGAAATTGAAGGAAACCCAGG - Intergenic
1014606597 6:123481784-123481806 GTGGAATTGGAGGAAAACTCAGG - Intronic
1015641541 6:135338744-135338766 GTTGACTTGTAAGGATACCACGG - Intronic
1017916000 6:158832047-158832069 GTGAATTTGGAAGGAGAACCTGG + Intergenic
1018017496 6:159725700-159725722 GAGGAATTGGAAGGATATCCTGG - Exonic
1018967130 6:168497666-168497688 GTGGTCTTGTCAGGAAAACCTGG + Intronic
1020868094 7:13591250-13591272 GTGGACATGCACGGAAACCCAGG - Intergenic
1021224989 7:18016109-18016131 CTAGACTTGTAAGGAAACCATGG - Intergenic
1025051630 7:55738453-55738475 GTCGCCTTGGAAGGCATCCCTGG - Intergenic
1025128593 7:56364120-56364142 GTCGCCTTGGAAGGCATCCCTGG - Intergenic
1027541815 7:79476521-79476543 GTTGAATTGGAATGAAACGCAGG + Intergenic
1033045260 7:137956426-137956448 TTGCACTGGGGAGGAAACCCGGG - Intronic
1033310729 7:140260054-140260076 GTGCACAAGGAGGGAAACCCAGG + Intergenic
1034412350 7:150947969-150947991 GAGGACTGGGCAGGAAGCCCTGG + Intronic
1034972414 7:155427528-155427550 GTGGACTTGGAAGGACGGCCGGG - Intergenic
1035127576 7:156619515-156619537 GTGGACCTGGAAGGAAACTGAGG - Intergenic
1036631441 8:10518737-10518759 GTGGACCTGGAGAGAAACACAGG + Intergenic
1038607024 8:29017133-29017155 GTGGAGTTGGCAGAAGACCCTGG + Intronic
1042759150 8:72252149-72252171 GTGCACATGGAGGGAAACACAGG - Intergenic
1045893206 8:107182496-107182518 GTGGACTTGAGAGGAAAGCAAGG - Intergenic
1047861114 8:128968121-128968143 GTGAGCTTGGAAGGAAAAACTGG + Intergenic
1051041348 9:12816114-12816136 GTCGAAATGGAAGGAAATCCTGG + Intronic
1051221953 9:14858182-14858204 GTGGACCTGGAAGGATACGCAGG - Intronic
1053347374 9:37387772-37387794 TGGCACTTGGAAGGAAACCCAGG + Intergenic
1053689458 9:40576163-40576185 CTGGATATGGGAGGAAACCCTGG - Intergenic
1054274573 9:63054894-63054916 CTGGATATGGGAGGAAACCCTGG + Intergenic
1054300703 9:63377102-63377124 CTGGATATGGGAGGAAACCCTGG - Intergenic
1054400251 9:64710035-64710057 CTGGATATGGGAGGAAACCCTGG - Intergenic
1054433842 9:65194293-65194315 CTGGATATGGGAGGAAACCCTGG - Intergenic
1054496544 9:65827377-65827399 CTGGATATGGGAGGAAACCCTGG + Intergenic
1058969710 9:110069669-110069691 GAGGACTAGGAAGGAGAACCAGG + Intronic
1060107001 9:120878753-120878775 CTGAACCTGGAAGGAAAGCCTGG + Intronic
1060731015 9:126037110-126037132 GGAGACTGGGAAGGAAACTCAGG - Intergenic
1061063463 9:128262800-128262822 GTGGCACTGGAAGGAACCCCAGG + Intronic
1187654673 X:21457742-21457764 GTTCACTTGGAAGGAAACTTAGG + Intronic
1188853366 X:35159883-35159905 GTGGACTTGGTAGAAATCCCTGG + Intergenic
1192220143 X:69192147-69192169 GTGGCCTGGGATGGAAACTCTGG + Intergenic
1195084394 X:101400578-101400600 TTGGACTTTGAAGGAGACCTTGG + Intronic
1198190397 X:134299067-134299089 GTGAACTTGAAAGGCAATCCAGG + Intergenic
1200022315 X:153222382-153222404 GAGGCCTTGGAATGAAACCAGGG + Intergenic