ID: 960294361

View in Genome Browser
Species Human (GRCh38)
Location 3:115925082-115925104
Sequence CCTTCCAAGTCCACTCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960294353_960294361 23 Left 960294353 3:115925036-115925058 CCTGCCTGTGGGGCTCATAGTCT 0: 1
1: 0
2: 2
3: 12
4: 151
Right 960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 174
960294358_960294361 -3 Left 960294358 3:115925062-115925084 CCTTGGTTCTGCCTGGGTTTCCT 0: 1
1: 0
2: 3
3: 37
4: 408
Right 960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 174
960294354_960294361 19 Left 960294354 3:115925040-115925062 CCTGTGGGGCTCATAGTCTGCTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 174
960294352_960294361 24 Left 960294352 3:115925035-115925057 CCCTGCCTGTGGGGCTCATAGTC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG 0: 1
1: 0
2: 1
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960294361 Original CRISPR CCTTCCAAGTCCACTCTTTG AGG Intronic
900764834 1:4497827-4497849 CCTTCCATGGCCTCTCTCTGTGG + Intergenic
900914606 1:5627337-5627359 CCTTCCGAGGCCTCTCTTTCTGG + Intergenic
902525237 1:17053262-17053284 CATTCCATGTCAACTCTATGAGG + Intronic
902640816 1:17765039-17765061 CCTTCCAACTCCACTCTGGCTGG - Intronic
908480302 1:64533053-64533075 CCCTGCAAGGCCCCTCTTTGGGG - Intronic
910031390 1:82729018-82729040 CTTTCCAAGTGATCTCTTTGAGG + Intergenic
910936989 1:92492242-92492264 CCTGCCAAGTCCACACTGTTGGG - Intergenic
911904701 1:103552137-103552159 CCTACCAAATCAACTCTTTCAGG - Intronic
913416929 1:118619116-118619138 CCTTCCAAGTCCACTGGCTTTGG + Intergenic
916038587 1:160943094-160943116 CCTTCCACCACCACTCATTGCGG + Intergenic
916043875 1:160983407-160983429 CCTTCCAGGTTCCTTCTTTGAGG + Intergenic
917036002 1:170747432-170747454 ACTTCCAACTCCACTTTTTGGGG + Intergenic
917791039 1:178498975-178498997 CCTCCCAGGACCACTCTCTGGGG + Intergenic
920268320 1:204743536-204743558 CCTTCCAAGTCCAGGCTCTGGGG + Intergenic
920826465 1:209427971-209427993 CCTTCCAAGTGCACACCTGGAGG - Intergenic
922881797 1:228986556-228986578 CCTCCCCATTCCACTCTTTTGGG - Intergenic
1067695506 10:48532423-48532445 CCTTCCAATTCCAATGTCTGTGG - Intronic
1069700908 10:70425101-70425123 ACTTCCAAGTTCTCTCTTTGTGG + Exonic
1071683261 10:87728865-87728887 CCTTTTAAGTCCCCTGTTTGTGG + Intronic
1077242566 11:1518262-1518284 CCTTCCAAGTGAGCTCTTTGAGG - Intergenic
1078619704 11:12895743-12895765 CCTTCCAGTTCTACTTTTTGGGG + Intronic
1082968885 11:58998269-58998291 ACTTCCAAGTACAGCCTTTGTGG + Intronic
1083998754 11:66284769-66284791 TCTTCCAGGTGCGCTCTTTGCGG - Exonic
1084681441 11:70668776-70668798 CCTTCCAACCCCACTCTGTCTGG - Intronic
1089550433 11:119271795-119271817 CTTTCCAAGTGGACTCTTTCAGG + Exonic
1090429638 11:126635234-126635256 CCTTCTAAATCCACTCATGGGGG + Intronic
1091273568 11:134334218-134334240 GCCACCAAGTTCACTCTTTGTGG + Intronic
1091459819 12:635456-635478 GCTTCCAAGACCACTCAATGGGG + Intronic
1091760375 12:3083567-3083589 CCATCAAGGACCACTCTTTGGGG - Intronic
1092029742 12:5274386-5274408 CATTCCACGTCCACTCTTACAGG + Intergenic
1094812385 12:34151246-34151268 ACTTCCAAGCACACTCATTGTGG - Intergenic
1096094605 12:48925906-48925928 TCTTCCAAGTCGTCTCCTTGTGG + Intronic
1098220452 12:68264744-68264766 CTTTCCATGTCCTCTCTCTGTGG - Intergenic
1101575795 12:105995336-105995358 CCTTCACAGTCCCCTCTGTGGGG - Intergenic
1101884866 12:108653839-108653861 CCTTCCAAGTCCATGGTGTGTGG + Intronic
1102243917 12:111343064-111343086 CCTTCCCTGTCCCTTCTTTGAGG - Intronic
1105884322 13:24628971-24628993 CCTTCCAAGTTCACACTTTATGG - Intergenic
1107865759 13:44701688-44701710 CCCTCCAATTCCTTTCTTTGTGG + Intergenic
1108712960 13:53052249-53052271 CCTTTAAAATCCACTCTTTCTGG + Intergenic
1110403548 13:75122292-75122314 CCTTCAAATGCCACACTTTGGGG + Intergenic
1111994655 13:95152885-95152907 ACTTCAAAGTCAAATCTTTGAGG + Intronic
1116176170 14:41473190-41473212 CCTTGCCAGCCCAGTCTTTGGGG + Intergenic
1117714371 14:58565366-58565388 CCATCCAAGCCCACTGTCTGAGG - Intergenic
1118652888 14:67916580-67916602 ACTTCCAAGCCCAAGCTTTGAGG - Intronic
1121507960 14:94490848-94490870 CATTCCAGGTCCACCCCTTGAGG + Intronic
1121587647 14:95073990-95074012 CATTGCATGTCCACCCTTTGAGG + Intergenic
1121712016 14:96045496-96045518 CCATCCAACTCCACTCCATGAGG - Intronic
1122004424 14:98690286-98690308 TCTTCTAAGTTCATTCTTTGAGG - Intergenic
1122402149 14:101473868-101473890 CCTTCCAATTCTGTTCTTTGTGG + Intergenic
1124055507 15:26237898-26237920 CCTTCCAAGTCCTCTCTGGAAGG + Intergenic
1125175707 15:36819021-36819043 CCTTCCAAATTCATTCTTAGTGG - Intergenic
1125272211 15:37952202-37952224 CCTGCCAAGTCCACTGTGTCTGG - Intronic
1125586764 15:40826150-40826172 CCTCCCAAGCCCACTCACTGAGG - Intronic
1125781127 15:42269551-42269573 CCTTACAAGTCTCCTGTTTGGGG - Intronic
1126052665 15:44700938-44700960 CCTTCTATGTCCAGTTTTTGGGG + Intronic
1128896116 15:71375597-71375619 CCTTCCAACTCCACTCACAGAGG - Intronic
1129034375 15:72640719-72640741 CCCTGCAAGTCCAGTCCTTGGGG + Intergenic
1129215507 15:74096497-74096519 CCCTGCAAGTCCAGTCCTTGGGG - Intergenic
1129391916 15:75224963-75224985 CCCTGCAAGTCCAATCCTTGGGG + Intergenic
1129472458 15:75763199-75763221 CCCTGCAAGTCCAGTCCTTGGGG - Intergenic
1129732649 15:77940826-77940848 CCCTGCAAGTCCAATCCTTGTGG - Intergenic
1130928047 15:88399618-88399640 CCTTGCAACTCCACTATTTTAGG + Intergenic
1131129600 15:89888536-89888558 GATTCCAAGTTCACTCTCTGAGG + Exonic
1135807200 16:25553680-25553702 TCTTCCATGTCCCCTCTCTGTGG - Intergenic
1135910194 16:26553471-26553493 CCTTCCTAGGCCACACCTTGAGG - Intergenic
1137585128 16:49659756-49659778 CCTTCCCAGACCCCTCTATGAGG - Intronic
1138531321 16:57635883-57635905 GCTTCCAGGGCCACTCTATGAGG - Intronic
1138792912 16:59929568-59929590 CCTTCCAAAACCAGTCTTTAAGG - Intergenic
1141240645 16:82262193-82262215 ACTCCCCTGTCCACTCTTTGGGG + Intergenic
1144430239 17:15184485-15184507 CATTCCAATTCCACTCTTTAAGG - Intergenic
1144844469 17:18209236-18209258 CCTTCCAAGTCTAGCATTTGGGG + Exonic
1146798193 17:35797720-35797742 CCATCTATGTCCCCTCTTTGAGG - Intronic
1148480099 17:47954399-47954421 CCTTCCAACTCCTGTCCTTGTGG - Intronic
1148706123 17:49634294-49634316 TTTCCCAAGTTCACTCTTTGTGG - Intronic
1149004123 17:51787182-51787204 ACTTCCAAGTTCATTCTATGAGG - Intronic
1152160802 17:78667399-78667421 CCTCCCAAGCCCACCCTCTGAGG - Intergenic
1152284496 17:79404318-79404340 CCTCCTAAGCCAACTCTTTGAGG + Intronic
1203180292 17_KI270729v1_random:51339-51361 CCTTTCAAATCCATTCTTTTCGG - Intergenic
1153908333 18:9684041-9684063 TCTCCCAAGTCCTCTCTTTATGG + Intergenic
1155745514 18:29352305-29352327 CTTTCCAATTCCTCTGTTTGTGG - Intergenic
1156693490 18:39737023-39737045 CATTCTAAGCCCACACTTTGTGG - Intergenic
1157176895 18:45459992-45460014 CCATCCAGGTCCAATCTTTTTGG + Intronic
1158653363 18:59307449-59307471 CCTTATAAGTCCCCTCTTTGGGG - Intronic
1159022770 18:63156689-63156711 CCTCCCAAGTCCAGACGTTGTGG + Intronic
1162565062 19:11441404-11441426 CCTTGCAAGCCCACACTATGAGG - Intronic
1163669813 19:18620842-18620864 CCTTCTATGTCCCCTCTCTGCGG + Exonic
1165456070 19:35911418-35911440 CCACCCGAGTCCATTCTTTGGGG - Intergenic
925602290 2:5620920-5620942 CCTATCCAATCCACTCTTTGAGG - Intergenic
927002631 2:18814344-18814366 CTTTCCAAGTCCTGCCTTTGGGG + Intergenic
931104097 2:59035142-59035164 TCTCCTAAGTCCTCTCTTTGAGG + Intergenic
932624942 2:73290063-73290085 CCTTCCAAGTGAACTCTTCATGG - Intergenic
935390912 2:102551863-102551885 CCTTCCAAGCACATTCTTTTTGG - Intergenic
936476715 2:112845961-112845983 CCTTCCAAGTCCTCACTTGCTGG + Intergenic
936794619 2:116190103-116190125 ACTTCCAAATTCACTCTTTAAGG - Intergenic
937375756 2:121334764-121334786 CCTTCCAAGTCCTCACGGTGGGG + Intergenic
938072703 2:128317046-128317068 CCTTCCCAGCCCAGACTTTGGGG + Intronic
940798595 2:158107459-158107481 TCTTCCAAGTCCAATCTCTAGGG + Intronic
940862654 2:158786836-158786858 ACCTCCAGGTCCACTCTTTGGGG - Intergenic
942686637 2:178539623-178539645 ACATCCAAGTCCGCTCTGTGAGG - Exonic
943845401 2:192639241-192639263 ACTTCCAAACCCACTCTATGAGG + Intergenic
944410780 2:199440238-199440260 CCTTCCTAATCTCCTCTTTGTGG + Intronic
945315388 2:208365679-208365701 ACTTCCAAGGTCATTCTTTGAGG - Intronic
947820376 2:233064764-233064786 CCTCCCAAGTCCCTTCTCTGCGG - Intronic
1169586954 20:7096206-7096228 CCTTCCCAGTCCACTGTCTCTGG - Intergenic
1171460685 20:25296372-25296394 CCTTCTTGGTCCACTCCTTGGGG - Exonic
1172144864 20:32749936-32749958 CCTTCACAATCCACTCTTAGAGG + Intergenic
1173168494 20:40703300-40703322 CCTTCCCAGTCCCATCTCTGTGG - Intergenic
1178371476 21:32030681-32030703 CCATCCAGGTCCACTCTATCTGG + Intronic
1179033191 21:37737868-37737890 CCTTCCAAGTTCATTCACTGTGG - Intronic
1179430177 21:41316402-41316424 CCGTCCATGTCCACTGTCTGAGG - Intronic
1182438101 22:30343907-30343929 CCTTTCAAGTCAGATCTTTGAGG + Intronic
1184094665 22:42310062-42310084 CCTTCAAAGTCCACCTTTTCTGG - Intronic
1184601648 22:45547328-45547350 CCTTCCATGTCCACCCTTGGAGG + Intronic
1185191846 22:49443029-49443051 CCTTCCCACTCCATTCTTTTAGG - Intronic
951332643 3:21384852-21384874 CCCTCCAAGGCTATTCTTTGTGG - Intergenic
953491483 3:43356020-43356042 CCTTCCTAGCTCATTCTTTGAGG + Intronic
954546573 3:51441122-51441144 ATTTCCTATTCCACTCTTTGAGG + Intronic
956329464 3:68089647-68089669 TCTGCCAACTCCAATCTTTGTGG + Intronic
957262034 3:77914335-77914357 CCTTCCAATTCCACTGGATGTGG + Intergenic
959127448 3:102307532-102307554 CCTTCCAAGTCCACTGACTCTGG - Intronic
960294361 3:115925082-115925104 CCTTCCAAGTCCACTCTTTGAGG + Intronic
961700047 3:128736814-128736836 CCTTCCAAGTCCACACATGTAGG - Intronic
966069537 3:175858611-175858633 CATTCCAATTCCACTCTTTTGGG - Intergenic
967038552 3:185666972-185666994 CCTTTCCAGTTCATTCTTTGAGG + Intronic
967707078 3:192663546-192663568 CCTTCCATGTCATCTCTCTGGGG + Intronic
967895135 3:194389327-194389349 CTTTCCAAGTCCAGGCTCTGGGG - Intergenic
968570493 4:1338012-1338034 CCTCCCTTGTCCCCTCTTTGTGG + Intronic
969943182 4:10755553-10755575 CCAGCCAAGTCCACTTTTTAAGG - Intergenic
970060884 4:12032940-12032962 CGTTCCTAGTCCCCTCTCTGTGG + Intergenic
972958737 4:44425068-44425090 TCTTCTAAGGCCTCTCTTTGTGG - Intronic
975333123 4:73142385-73142407 CCTTCCATATTCACTCTTTTAGG - Exonic
976451956 4:85200164-85200186 CCTTCCTAGTCCACTGTTCCTGG + Intergenic
976802266 4:89006270-89006292 CCTTCCAAGGCAACTCTTACAGG + Intronic
979292250 4:118991009-118991031 CCTTCCAAGTCAACTCCTTTGGG + Intronic
981067536 4:140500473-140500495 CATTTCAAGTCCACTCTTTTAGG - Intergenic
981340444 4:143615905-143615927 GCTTCCAAGTCAGCTCTGTGAGG - Intronic
983207636 4:164927466-164927488 TCTTCCAAGTCCCCTTTTTCAGG + Intergenic
983211153 4:164959451-164959473 TCTTCCAAGTCCCCTTTTTCAGG - Intronic
984148287 4:176092079-176092101 ACTTCCAAACCCATTCTTTGAGG + Intronic
985450866 4:190061438-190061460 TCTTCCATTTCCACTGTTTGAGG + Intergenic
985514969 5:337721-337743 CCTTCCAAGCGCACTCCTTAGGG - Intronic
987519299 5:18958528-18958550 TCTTGGAAGGCCACTCTTTGGGG + Intergenic
993418700 5:87671896-87671918 CCTTCCAAGTTCCTTCTTTCTGG + Intergenic
994099793 5:95880235-95880257 CCCTACAAATCCACTTTTTGGGG - Intergenic
997069654 5:130606308-130606330 CCTTCCAAGAACATTCTATGTGG - Intergenic
998798670 5:145845618-145845640 AATTCCCAGTCTACTCTTTGAGG - Intergenic
999596408 5:153210106-153210128 CCTTCCAGGACCCCTCTCTGAGG + Intergenic
1001928846 5:175658488-175658510 CTTTCCAAATCCACCCTTCGCGG - Intronic
1003562088 6:7189267-7189289 CCTTACAAGTGCACTGTGTGTGG + Exonic
1003655181 6:8000438-8000460 CCTTCCAACTCCATTATTTCAGG + Intronic
1004699832 6:18068545-18068567 CCTTTCATTTCCACTCTTTGAGG + Intergenic
1005225583 6:23638426-23638448 CCTTCCATTTCCACAATTTGGGG - Intergenic
1006777611 6:36608064-36608086 TCTTCCAACCTCACTCTTTGAGG - Intergenic
1007249269 6:40484568-40484590 CCCTCCAAGTATACTCTTAGCGG - Intronic
1007343702 6:41210210-41210232 CCTCCCAGGTCCCCTCTGTGTGG + Intergenic
1011473529 6:87731127-87731149 ACTTCCATGTCCACTTTGTGGGG - Intergenic
1012089787 6:94876387-94876409 CCTTCCCAGTTCACTCTTAGAGG + Intergenic
1012758524 6:103264370-103264392 CCATCCCAGTCAACTCCTTGTGG - Intergenic
1016347433 6:143129355-143129377 ACCTCCACGTACACTCTTTGGGG + Intronic
1019470144 7:1215279-1215301 CATTCCAGTTCCACTCTTGGTGG + Intergenic
1021820326 7:24491437-24491459 CTTTCCTAGTCTACTATTTGTGG - Intergenic
1023297420 7:38729798-38729820 CCTTTCATGTCCATTCTGTGGGG + Intronic
1023645506 7:42309215-42309237 ACTTCCAAATTCACTCTATGAGG + Intergenic
1029724964 7:102396655-102396677 CCCTCCAAGAGCAGTCTTTGGGG + Intronic
1030085028 7:105808490-105808512 CAGTCCAAATCCACTCTCTGTGG + Intronic
1031033712 7:116764586-116764608 CCTTCCAAGCACAGTCTTTATGG + Intronic
1031148795 7:118028538-118028560 CCTTCCAGAACCACTCATTGAGG + Intergenic
1033984406 7:147205879-147205901 CTTTCCAGTTCCACTCTTTTAGG - Intronic
1035392685 7:158515911-158515933 CCTTCATAGTCCAGTCTTTCTGG + Intronic
1039893100 8:41697601-41697623 GCGTCCGAGTCCACTCTTTCTGG + Intronic
1041375975 8:57209705-57209727 CCTTCCAGGTCCACTCTGAAGGG - Intergenic
1044058046 8:87597117-87597139 CTTTCCTAGTACACTATTTGTGG + Intronic
1044178006 8:89153750-89153772 CCTTCCAATTCCACTCTTGGAGG - Intergenic
1045991116 8:108309629-108309651 CCTTCCAAGCTCATTCTATGAGG + Intronic
1046047243 8:108978747-108978769 ACCTCCAAGACCACTCTTTATGG + Intergenic
1047259808 8:123245431-123245453 CGTTCCAAGTCCATTCAATGGGG + Intronic
1047314455 8:123719758-123719780 ACTCCCAAGTCCACACTATGTGG - Intronic
1052768350 9:32664656-32664678 CCTTCAAAGTCCTTTTTTTGAGG + Intergenic
1052975270 9:34405571-34405593 ACTTCCAAGTCCTCTCTCTGGGG + Intronic
1057435987 9:95040925-95040947 CTTTCCAGGTACAATCTTTGAGG - Intronic
1060573260 9:124663657-124663679 CCTTCTATTTCCATTCTTTGTGG - Intronic
1061945928 9:133908143-133908165 CCACCCAGTTCCACTCTTTGGGG - Intronic
1185966926 X:4616068-4616090 CCATCCATGTTCACTATTTGGGG + Intergenic
1187856828 X:23644887-23644909 CCTTGAAAATCCACTCTGTGCGG + Intergenic
1190407564 X:50102915-50102937 CCCTTCAAGTCCAATGTTTGCGG + Intergenic
1193163616 X:78257356-78257378 CCCTCCCAGTCCACTGTTTCTGG + Intergenic
1194541808 X:95182287-95182309 CCTTTCAAGTACATTATTTGAGG - Intergenic
1194857681 X:98954418-98954440 ACTTCCAAATTCATTCTTTGAGG - Intergenic
1197210174 X:123821753-123821775 CCTGCCCAGACCACACTTTGTGG - Intergenic
1197870298 X:131057935-131057957 CCTTCAAATTCCAGCCTTTGGGG + Intergenic
1199570670 X:149264160-149264182 CATCCCAAACCCACTCTTTGTGG + Intergenic