ID: 960298188

View in Genome Browser
Species Human (GRCh38)
Location 3:115968999-115969021
Sequence AAGGTGAGCTCAGTGATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 8, 3: 53, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960298188_960298195 23 Left 960298188 3:115968999-115969021 CCTACAATCACTGAGCTCACCTT 0: 1
1: 0
2: 8
3: 53
4: 318
Right 960298195 3:115969045-115969067 ACCCACACAACCACTGTCAGGGG 0: 1
1: 0
2: 0
3: 9
4: 195
960298188_960298193 21 Left 960298188 3:115968999-115969021 CCTACAATCACTGAGCTCACCTT 0: 1
1: 0
2: 8
3: 53
4: 318
Right 960298193 3:115969043-115969065 TGACCCACACAACCACTGTCAGG 0: 1
1: 0
2: 3
3: 12
4: 125
960298188_960298194 22 Left 960298188 3:115968999-115969021 CCTACAATCACTGAGCTCACCTT 0: 1
1: 0
2: 8
3: 53
4: 318
Right 960298194 3:115969044-115969066 GACCCACACAACCACTGTCAGGG 0: 1
1: 0
2: 0
3: 5
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960298188 Original CRISPR AAGGTGAGCTCAGTGATTGT AGG (reversed) Intronic
901681041 1:10913007-10913029 AATGAGAGCTCAGGGAATGTGGG + Intergenic
903021492 1:20398482-20398504 AAATTGAGCTCTGTGATTTTGGG - Intergenic
904132088 1:28282608-28282630 AACTTGTGCCCAGTGATTGTAGG + Intergenic
904595895 1:31645043-31645065 CAGGGGAGCTAAGTGATTGATGG + Intergenic
905383600 1:37582628-37582650 AAAGTGTGCTCATTGATAGTGGG - Intronic
905401456 1:37706656-37706678 AAGCTGAGCTCAGTGTCTCTGGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906098147 1:43238135-43238157 ATGGTGAGCCCACTGACTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
911280722 1:95924724-95924746 TAGGTGACCACAGTGAGTGTAGG - Intergenic
911575121 1:99566994-99567016 AATGTAAGTTCAGTGATTTTAGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
913225277 1:116693515-116693537 GAGGTGAGCTCTGTGTATGTGGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915572591 1:156752432-156752454 AAGATGAGCTCAGTTCTAGTCGG + Exonic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915982558 1:160430056-160430078 AAGGTTAGCTCAGTGAGGGCAGG - Intergenic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
921264826 1:213413813-213413835 AAGATGGCCTCAGTGATTCTGGG - Intergenic
921558657 1:216629827-216629849 AATTTGAGCTCTGTGACTGTGGG - Intronic
921607886 1:217176609-217176631 AAAGTAAGCTCTGTGACTGTAGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
1065711969 10:28527033-28527055 AAGGAAAGCTCTGTGATTGAAGG - Intergenic
1066228368 10:33407190-33407212 AAGGAGAACTGAGTGAGTGTGGG + Intergenic
1066531933 10:36350471-36350493 AAGGTGTCCACAGTGAGTGTGGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1070168911 10:73917843-73917865 GAGGTCAGCTCAAGGATTGTTGG - Intronic
1071103074 10:82061645-82061667 AGAGTGAGCTCAGTGAATGCTGG + Intronic
1071280297 10:84095448-84095470 AGGTTGAGGTCAGTGATAGTTGG - Intergenic
1073270840 10:102262557-102262579 AGGGTGATCTCAGTCATTTTAGG - Intronic
1074236818 10:111593041-111593063 CAGTTGAGCTCAGTGATTAGGGG - Intergenic
1074516514 10:114174781-114174803 AAGCTGAGCGCATTGATGGTAGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075235395 10:120723142-120723164 AAGGTGAGCTGAGCGAAGGTGGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077577476 11:3395562-3395584 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077579393 11:3407216-3407238 GAGCTGAGCTCAGGGAATGTCGG + Intergenic
1077603975 11:3594680-3594702 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078846475 11:15123314-15123336 ATGATGAGCTCTGTGAGTGTTGG + Intronic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079544318 11:21614327-21614349 AAGGTGATTTCTGTGAGTGTTGG - Intergenic
1080396810 11:31897809-31897831 GAGGAGAGCTCAGTTAGTGTGGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1082250692 11:49976819-49976841 AAGGTGAGAGCAGTGCTTGTAGG + Intergenic
1082559353 11:54600422-54600444 AAGCTGAGAGCAGTGCTTGTAGG - Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1082988486 11:59187411-59187433 GAGGTGAGCTCTGTGCATGTTGG + Intronic
1083464186 11:62834317-62834339 ATCCTCAGCTCAGTGATTGTGGG - Exonic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084226427 11:67717497-67717519 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084229427 11:67740344-67740366 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084236428 11:67790759-67790781 GAGCTGAGCTCAGGGAATGTCGG + Intergenic
1084259872 11:67969272-67969294 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1084812899 11:71625980-71626002 AAGGGCAGTTCAGTGAATGTAGG + Intergenic
1084835988 11:71802234-71802256 GAGCTGAGCTCAGGGAATGTCGG - Intergenic
1084845871 11:71899352-71899374 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
1087032136 11:93716282-93716304 AAGGAGAGCTCAGCCATTCTGGG - Intronic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088705398 11:112458152-112458174 AAGGTGTATTTAGTGATTGTAGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089149158 11:116351391-116351413 AAGGTGAGCACACTGAGTGCAGG + Intergenic
1091750618 12:3019405-3019427 AAGCTGTGCTCAGGGCTTGTGGG + Intronic
1092407331 12:8230166-8230188 GAGCTGAGCTCAGGGAATGTCGG + Intergenic
1092434077 12:8432434-8432456 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1092782565 12:12001037-12001059 AAGATGAGTTCAGGGTTTGTAGG - Intergenic
1095230938 12:39738802-39738824 AAAGTGACCTTAGTAATTGTGGG + Intronic
1095820413 12:46472383-46472405 AGGGTGAGCTCAATGCTTGGTGG - Intergenic
1096689092 12:53308415-53308437 GAGGTGAGCTGAGTGGTTGAGGG - Exonic
1099161790 12:79250587-79250609 ATGGTGAAGTCAGTGATTTTAGG + Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1100331774 12:93589458-93589480 AAAGTGAGTTTAGTGATGGTGGG + Intergenic
1101584032 12:106068546-106068568 AAGGCAAGCTCACTGAGTGTTGG - Intronic
1102523923 12:113497498-113497520 AAGGTGGGGTCAATGATTGCAGG + Intergenic
1103221584 12:119250687-119250709 AAAATGAGCTCTGTGATTTTGGG + Intergenic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108663749 13:52609007-52609029 AATGTAAGCTCAGTGAGAGTAGG - Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1111485941 13:88898447-88898469 AATGTGTGTTCAGTTATTGTTGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1114303037 14:21395306-21395328 GAGGAGATCTCAGTGATTGATGG - Exonic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1124900939 15:33821704-33821726 AACGTGAGCTAAGTGATTCTGGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1131609793 15:93948574-93948596 AAGGTGGGCTCAGTGTTTTCAGG - Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132265423 15:100466203-100466225 CAGTGGTGCTCAGTGATTGTCGG - Intronic
1133348008 16:5083276-5083298 GAGCTGAGCTCAGGGAATGTCGG + Intronic
1133720490 16:8490062-8490084 AATGTCAGCTCTGTGAATGTAGG - Intergenic
1135174055 16:20212505-20212527 AAGGTGAGCTCAGTGTGTAGAGG - Intergenic
1137550333 16:49433211-49433233 AGGGTGAGCTAAATGATTGGTGG + Intergenic
1138678876 16:58671077-58671099 AAGGTGATCTCAGTCATTGGAGG - Exonic
1140596676 16:76424244-76424266 AATGTGAGTTCAATGATTTTGGG - Intronic
1141650761 16:85391808-85391830 CAGGTGAGCTCGGAGATTGGTGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1149142377 17:53447912-53447934 AAGATGAGCTCAGTGATTAGAGG + Intergenic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150619443 17:66798251-66798273 AAGGTTAGATCATTGATAGTAGG + Intronic
1151707318 17:75776274-75776296 GAGGTGACCTCAGTGACAGTTGG - Intergenic
1153326559 18:3826629-3826651 AAGGTGAGGACAGTGATTTGGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1156159689 18:34344582-34344604 AAGGTGAACAGAGTGACTGTGGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159339797 18:67119809-67119831 ACGGAAAGCTCAGTGATTGGGGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159616387 18:70584649-70584671 AAGGTGCACTCAGTGACTGGTGG - Intergenic
1162021792 19:7871452-7871474 ACGGTGAGGTCAGAGAATGTGGG + Exonic
1164739392 19:30565274-30565296 AAGGTCAGCTGAGTGAATGACGG + Intronic
1164957338 19:32397860-32397882 AATGTGATGTCAGTGACTGTGGG + Intergenic
1166216771 19:41340987-41341009 AAGTTGAACCCTGTGATTGTTGG - Intronic
1168097185 19:54122592-54122614 AAGGTGAGCGCAGAGAAGGTGGG + Exonic
925666208 2:6259089-6259111 GAGGTCAGCTCAGTATTTGTTGG - Intergenic
926239207 2:11072020-11072042 TAGGTGTGCTCAGTGCTTTTGGG - Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927856067 2:26528745-26528767 AAGGTGGGCTGGGTGATGGTTGG - Intronic
927989688 2:27439013-27439035 TCGGTGAATTCAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
932589907 2:73059074-73059096 ATTGTGAGCTCAGTGCTTTTAGG - Intronic
932627779 2:73312530-73312552 AAGGTGATCTCAGTAAGTTTGGG - Intergenic
934927654 2:98392681-98392703 AAGGAGAGCTCAGTCAATCTTGG + Intronic
935307547 2:101752010-101752032 CAGGTGACCTCTGTGTTTGTAGG + Intronic
936641539 2:114317355-114317377 AAGGAGAGCTCAGCGACTGGGGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
937210971 2:120270650-120270672 AAGGTCATTTCTGTGATTGTAGG + Intronic
937678428 2:124617801-124617823 AAGGTGTGCATAGTGCTTGTTGG + Intronic
938821693 2:134966876-134966898 AAGGGCAGTTCAGTGAGTGTAGG + Intronic
938890612 2:135701502-135701524 GAGGTGAGGTGAATGATTGTAGG + Intronic
939235425 2:139485959-139485981 AAGCTCAGTTAAGTGATTGTTGG - Intergenic
939294732 2:140245919-140245941 TAGGTGAGGTGAGTGATTTTTGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943329465 2:186541932-186541954 AAGGATAGCTCAGTGTTTGAGGG + Intergenic
944555468 2:200883981-200884003 AAGGTGAGCTCAGAAGTTCTAGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944887942 2:204084343-204084365 AAAGTGAGCCCAGTCCTTGTAGG + Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
947846879 2:233251711-233251733 GAGGTGAGCTCCGGGATTGCCGG + Exonic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1176292112 21:5051817-5051839 AATGTGGGCTGAGTGAATGTGGG - Intergenic
1176292116 21:5051882-5051904 AATGTGGGCTGAGTGAATGTGGG - Intergenic
1179865141 21:44211768-44211790 AATGTGGGCTGAGTGAATGTGGG + Intergenic
1179865145 21:44211833-44211855 AATGTGGGCTGAGTGAATGTGGG + Intergenic
1183302515 22:37065308-37065330 AAGGTGGGCTCAGTGGCAGTGGG - Intergenic
949216829 3:1580968-1580990 TAGCAGAGCTCAGTTATTGTGGG - Intergenic
950500343 3:13359671-13359693 AGGGTGAGCTGAGAGCTTGTGGG - Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952005844 3:28841586-28841608 ACAGTGCACTCAGTGATTGTCGG + Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
953794406 3:45973172-45973194 AAGCTGAGCTCGGACATTGTGGG - Exonic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956640682 3:71412696-71412718 AGGGTGAGCCCAGTGTTTCTTGG - Intronic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957052370 3:75420539-75420561 GAGCTGAGCTCAGGGAATGTCGG + Intergenic
957074826 3:75593695-75593717 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
957219061 3:77358905-77358927 AAGATGAGCACAGTCATTGTAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958942468 3:100331424-100331446 AACGTGAGCTCAGTTTTTGGGGG - Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959802539 3:110512467-110512489 AAGGTGAGGTCTGTGACTGCTGG - Intergenic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960094603 3:113677187-113677209 AATGTGAGCTCATTGCTTTTAGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960359297 3:116691482-116691504 AATGTAAGCTCAGTGAAAGTAGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
961276380 3:125730436-125730458 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
961875118 3:130016582-130016604 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
961878057 3:130039294-130039316 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963076574 3:141352992-141353014 AAGGGGAGGTCAGGGTTTGTTGG - Intronic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963953794 3:151230837-151230859 AAGATGAGCTCACTGACAGTGGG - Intronic
964127522 3:153251322-153251344 AATGTGAGCTCCCTGATTGCTGG - Intergenic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964604386 3:158544103-158544125 AAGGTGAGTTCTGTCATTTTAGG + Intronic
964960992 3:162426595-162426617 AAGATAAGCTCAGAGATTTTAGG - Intergenic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
966412389 3:179656995-179657017 GAGGTGATTTCATTGATTGTTGG + Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968990272 4:3906330-3906352 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969018426 4:4121333-4121355 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969023114 4:4151520-4151542 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
969730695 4:8955563-8955585 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969735557 4:8987385-8987407 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969758807 4:9167878-9167900 GAGCTGAGCTCAGGGAATGTCGG - Intergenic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969794777 4:9518840-9518862 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972742060 4:41896420-41896442 AATGTAAGCTCTGTGATAGTAGG + Intergenic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974877136 4:67714582-67714604 ATGGTGGGGACAGTGATTGTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
977686812 4:99856178-99856200 AATGTGAGCTCAGTGAGGGGAGG - Intronic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
980229969 4:130036680-130036702 AACGTAAGCTCAGTGAGGGTAGG - Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981466316 4:145076317-145076339 AGGCTCAGCTCAGTGCTTGTGGG - Intronic
982339723 4:154284589-154284611 AGGGTGAGCATGGTGATTGTGGG + Intronic
982522314 4:156433795-156433817 AAGGTGTGCTCATTGATACTGGG - Intergenic
982979200 4:162109515-162109537 AAGGTGACTTCAATGATTTTTGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983390705 4:167126670-167126692 TAGGTGAGCTCAGGTATAGTGGG - Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
985003854 4:185513148-185513170 AACGTGAGCTCAGTGTCTGCAGG - Intronic
985251174 4:188026063-188026085 AAGGTAAGCTCTATGACTGTGGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986677052 5:10195156-10195178 AAGCACAGCTCAGTGATTGGTGG + Intergenic
987400239 5:17467856-17467878 AAGGTGATGTGGGTGATTGTGGG + Intergenic
988575408 5:32418493-32418515 AAGGTGAGCTGAGTGAATTCTGG + Intronic
990026953 5:51203880-51203902 AATGAGAGCTCAGTAAATGTTGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994995581 5:107058259-107058281 AAGGTGGGCACAGTGGGTGTGGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995632633 5:114150525-114150547 AGGGTCAGCTCAGGGAATGTGGG - Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
997511859 5:134459708-134459730 GAGGGGAGCTCAGGGACTGTTGG - Intergenic
997627240 5:135339408-135339430 AAGGTGAGCTCACTGAGAGCAGG - Intronic
997762549 5:136463484-136463506 ATGCTGAGCACAGTGATTGGAGG - Intergenic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1000917036 5:167095124-167095146 AAAGTAAGCTCTGTGATTGGAGG - Intergenic
1001014410 5:168127353-168127375 AAGGTGAACTCACTAATTTTAGG + Intronic
1001419608 5:171576772-171576794 AAGGTGAGGTCAGTTCTTCTGGG - Intergenic
1001867463 5:175117701-175117723 AATGTGGGCTCAGTGCTTCTGGG - Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012738050 6:102976011-102976033 AATGTGAATTCAGTGTTTGTTGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013582435 6:111549669-111549691 AATGTGAGCTCAGTGAGGGTCGG + Intergenic
1014610443 6:123537663-123537685 AAGTTGAGCTCAGAGAGTCTGGG - Intronic
1014691363 6:124567487-124567509 AATGTGAGCTCCGTGAGGGTAGG + Intronic
1015218426 6:130777004-130777026 AAGCTGAGATAAGTGATTCTGGG - Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016407391 6:143744727-143744749 GCGGTGAGTTCAGGGATTGTTGG + Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016934650 6:149440786-149440808 AAGGTGAGCTCTGTGACAGCAGG + Intergenic
1017074759 6:150607303-150607325 AAGCTGAGCTCTGTGATGGCTGG - Intronic
1020310164 7:6861244-6861266 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020313102 7:6884384-6884406 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1020319441 7:6929237-6929259 GAGCTGAGCTCAGGGAATGTCGG + Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1022328641 7:29356483-29356505 TAGCTGAGCTCTGTGAATGTGGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028197727 7:87926769-87926791 AGGGTGAGGTCTGTGATTGCTGG + Intergenic
1028289919 7:89052391-89052413 AAGCTATGCTCAGTGATTGCTGG + Intronic
1028868178 7:95737092-95737114 AAGGAGAACCCAGTGACTGTGGG - Intergenic
1029076914 7:97942041-97942063 AAGGGCAGTTCAGTGAGTGTAGG - Intergenic
1029641107 7:101819939-101819961 AAGGTTAGCTCAGTGGATTTAGG - Intronic
1030107246 7:105997468-105997490 AAGGAGAGCTCAGTGCCTTTGGG + Intronic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1035397243 7:158543208-158543230 AAGGTGAGCTCCGTGCTCGGGGG - Intronic
1035718933 8:1776322-1776344 AAGGTGAACTCTGTGAGGGTTGG + Intronic
1036240862 8:7079927-7079949 AAGGGCAGTTCAGTGAGTGTAGG + Intergenic
1036847702 8:12181086-12181108 GAGCTGAGCTCAGGGAATGTGGG + Intergenic
1036869070 8:12423401-12423423 GAGCTGAGCTCAGGGAATGTGGG + Intergenic
1036902292 8:12679428-12679450 AAGGGCAGTTCAGTGAATGTAGG - Intergenic
1038924586 8:32124419-32124441 ATGGTGAGTTCACTGTTTGTTGG - Intronic
1039309498 8:36300560-36300582 AATTTGAGCTCAGTGCTTTTTGG - Intergenic
1041639625 8:60182552-60182574 AATGTGAGCACAGTTCTTGTGGG - Intergenic
1042463205 8:69094802-69094824 AACATGAGCTCAGTGATTTCTGG + Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043512237 8:80960979-80961001 AAGGTGAGGTTAGAGGTTGTCGG - Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046332956 8:112746015-112746037 AAGGTGAGTTCAAAGTTTGTGGG - Intronic
1046605458 8:116366447-116366469 AAAGTAACCTCAGAGATTGTGGG + Intergenic
1046620592 8:116525595-116525617 AAGGTGATCTCTGTGGCTGTGGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048599325 8:135902308-135902330 AATGTGTGGTAAGTGATTGTGGG - Intergenic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1050612369 9:7366390-7366412 AAGTTGAGGTCAGTTATTTTTGG + Intergenic
1050620799 9:7450062-7450084 AAGGTCAGCCCAGTGACTGGCGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052072048 9:24093429-24093451 AAGGCCAGCCCAGTGAGTGTGGG + Intergenic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052246116 9:26337407-26337429 AAGGGAAGTTCAGTGGTTGTTGG + Intergenic
1053118061 9:35522954-35522976 AAGGTCAGCAGAGTGATTATTGG + Intronic
1054810569 9:69430782-69430804 AAGGTTGGCTCAGAGATTCTGGG + Exonic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055160540 9:73121115-73121137 AATCCAAGCTCAGTGATTGTTGG - Intergenic
1055893064 9:81143834-81143856 AATATCAGCTCAGTAATTGTTGG - Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1056424287 9:86461163-86461185 AAGGTAAGCTCAGTGATTCTTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1061783528 9:133009443-133009465 AAGGTGATCTCAGTGTCTGGGGG + Intergenic
1062356400 9:136166054-136166076 AATGCAAGCTCAGTGATGGTTGG - Intergenic
1186770682 X:12815264-12815286 AAGGTGAGCTCTGTGGTTCTTGG - Intronic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189580883 X:42404972-42404994 AAGGTGAGATCAGTGAAGGGAGG + Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190947995 X:55114587-55114609 AACGTGAACCCAGTGATTATGGG - Intronic
1192168196 X:68839073-68839095 AAGGTGAGCTTGGTAAATGTTGG - Intronic
1192223233 X:69211505-69211527 AAGGTGAGTCCAGTGAGGGTAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1194399106 X:93421164-93421186 AAGGTGGGCTCTGTGCATGTGGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196025063 X:111033434-111033456 AAGGTGAGTGCAGTCAATGTGGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196530906 X:116785237-116785259 AATGTATGCTCTGTGATTGTTGG - Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198804918 X:140484750-140484772 AAGCTGAGCTCAGTGGCTGTGGG + Intergenic
1199398687 X:147371145-147371167 TAAATGAGTTCAGTGATTGTGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic