ID: 960308979

View in Genome Browser
Species Human (GRCh38)
Location 3:116097592-116097614
Sequence ATTACTTACTTATTTACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960308979_960308980 -8 Left 960308979 3:116097592-116097614 CCATGAGTAAATAAGTAAGTAAT 0: 1
1: 0
2: 2
3: 43
4: 356
Right 960308980 3:116097607-116097629 TAAGTAATGAGACTGTCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 160
960308979_960308981 10 Left 960308979 3:116097592-116097614 CCATGAGTAAATAAGTAAGTAAT 0: 1
1: 0
2: 2
3: 43
4: 356
Right 960308981 3:116097625-116097647 TCAGGACTACCATTAGAAAATGG 0: 1
1: 0
2: 0
3: 12
4: 156
960308979_960308983 23 Left 960308979 3:116097592-116097614 CCATGAGTAAATAAGTAAGTAAT 0: 1
1: 0
2: 2
3: 43
4: 356
Right 960308983 3:116097638-116097660 TAGAAAATGGCTCTACTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960308979 Original CRISPR ATTACTTACTTATTTACTCA TGG (reversed) Intronic
900074382 1:801321-801343 CTTTCTTATTTATTTACTCAGGG - Intergenic
901362315 1:8712732-8712754 ATTAATCACTTTTATACTCAAGG + Intronic
904325482 1:29725004-29725026 ATTACTTATTGATTTTCTCCAGG - Intergenic
906883871 1:49623046-49623068 ATTACTGATTTAATTACTGAAGG + Intronic
908013872 1:59811897-59811919 TTTATTTATTTATTTATTCAAGG + Intergenic
908869280 1:68589886-68589908 ATTAATTACCTCTCTACTCAGGG + Intergenic
909430209 1:75579440-75579462 TTTATTTACTTATTTATTTATGG - Intronic
909781263 1:79550519-79550541 ATAACTTACTTGTTTCTTCAGGG - Intergenic
909829314 1:80166001-80166023 TTTATTTACATATTTATTCACGG - Intergenic
910484378 1:87696670-87696692 TTTATTTACTTTTTTCCTCAAGG - Intergenic
911831614 1:102556618-102556640 AGTGCTTACTTATTTATTCAAGG - Intergenic
912121510 1:106477739-106477761 ATTTCTTACTGATTTAATCTAGG - Intergenic
912239008 1:107885481-107885503 ATTACTTATCAATTTACTCCTGG - Intronic
913019420 1:114772720-114772742 AATAGTTACTTACTTACTCTTGG + Exonic
913614299 1:120541707-120541729 TTTACTTACTTATTTAGAGATGG - Intergenic
913712341 1:121497682-121497704 ATTACCTACATATTGAATCAAGG - Intergenic
914575970 1:148969193-148969215 TTTACTTACTTATTTAGAGATGG + Intronic
914908357 1:151765085-151765107 ATGACTTCCTCCTTTACTCAAGG + Intronic
916611689 1:166397977-166397999 ATGCCTTTCTTATTTATTCAAGG + Intergenic
917144427 1:171873480-171873502 ATAATTTACTTATTTACTTTGGG - Intronic
918594835 1:186280943-186280965 TTTACTTATTTATTTATTCATGG - Intergenic
919212388 1:194504413-194504435 AATACATACATATTTACTAAAGG - Intergenic
919270099 1:195330336-195330358 AATACTTGCTTATTATCTCAAGG - Intergenic
920285568 1:204876419-204876441 ATTATTTTCTTATTTCATCATGG + Intronic
921438460 1:215155963-215155985 AGTACTTCCTTATTAACTAATGG - Intronic
921923677 1:220694396-220694418 ATCACTTACTTAATTTCCCATGG - Intronic
922013665 1:221620556-221620578 ATTGCTTAATTATTTACACAAGG + Intergenic
922270231 1:224026225-224026247 CTTTCTTATTTATTTACTCAGGG - Intergenic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
923116932 1:230949045-230949067 ATTCCACAATTATTTACTCAGGG + Intronic
923959846 1:239066877-239066899 CTTTCTTAGTTATTTACCCAGGG + Intergenic
1063641834 10:7837883-7837905 ATTACTTACTGATTTAATAGAGG + Intronic
1063923192 10:10951678-10951700 TTTTCTTTCTTCTTTACTCAAGG - Intergenic
1064816697 10:19273492-19273514 ATTACCTATTTATCTACTGAAGG - Intronic
1064886360 10:20117262-20117284 ATTATTTATTTATGTACTCTTGG - Intronic
1066329645 10:34406494-34406516 ATTAGTTTCTTTTTTTCTCATGG - Intronic
1067002047 10:42624709-42624731 ATTACTAAGTAATTAACTCATGG + Intronic
1067043814 10:42973368-42973390 ATTACCTCTTTATTTAGTCATGG + Intergenic
1067545020 10:47186661-47186683 ATAATTTGCTTATTTACTCATGG - Intergenic
1068394145 10:56439414-56439436 TTTATTTACTTATTTTTTCATGG - Intergenic
1069314777 10:67083715-67083737 ATTTCTTAATTATTTATTAAGGG - Intronic
1070262826 10:74874065-74874087 ATTACTTACCCTTTTACACAAGG - Intronic
1072178680 10:92957098-92957120 TTTAGTTACTTATTTATCCAAGG + Intronic
1072850940 10:98891368-98891390 ATTTATTTCTAATTTACTCATGG + Intronic
1073873388 10:107892120-107892142 ATTACTGACTTGGCTACTCAGGG + Intergenic
1074253177 10:111774291-111774313 ACCACTTACTTATTTGCTCATGG - Intergenic
1074480834 10:113819077-113819099 TTTATTTACTTATTTAGACATGG + Intergenic
1074999931 10:118788391-118788413 ATTTCTTACTGATTTAATCTGGG - Intergenic
1077866594 11:6226926-6226948 ATTACTTTCTTATTTTCAAATGG - Intronic
1078988400 11:16617899-16617921 ATTACTTAATTATTAAATTATGG + Intronic
1079409055 11:20169896-20169918 ATTACTTACTTTCTTTCTCTAGG - Intergenic
1080349090 11:31361052-31361074 ATTCATTACATATTTACTGAGGG - Intronic
1080901823 11:36500987-36501009 ATTATTTACTTATTTATCCAAGG + Intronic
1080987003 11:37480677-37480699 ATCACTTACTTTTTTCCTCATGG + Intergenic
1081521303 11:43884004-43884026 ATTACTTACTCAATCACTCGTGG - Exonic
1082643738 11:55696053-55696075 ATTTCTTCCTTATTTTCTGAAGG - Intergenic
1082880203 11:58029638-58029660 ATTATTTAGTGATTCACTCATGG + Intronic
1082923872 11:58525059-58525081 ATCACGTACTTATTTACTTTTGG - Intergenic
1083042042 11:59698128-59698150 ATTACTTCATGATTTAGTCATGG + Intergenic
1086621531 11:88892007-88892029 ATAACTTACTTAATTATTAAAGG - Intronic
1087204577 11:95380601-95380623 TTTACTTACTTTTTTCCACAAGG + Intergenic
1087484472 11:98744330-98744352 ATTACTTAGTTAGTTTCTTATGG + Intergenic
1087544250 11:99564086-99564108 TTTACTTATTTATTTAGACAGGG + Intronic
1088509230 11:110557541-110557563 ATTTCTTCCTTATTTACTCTTGG + Intergenic
1089742511 11:120594468-120594490 ATTATTTATTTATTTAGACAGGG - Intronic
1089913820 11:122131639-122131661 CTTATTTTCTTATTGACTCAAGG - Intergenic
1091851949 12:3706603-3706625 ATTACTTATTTATTTAGAGACGG + Intronic
1092337606 12:7647479-7647501 ATTATTTATTTATTTATTTATGG + Intergenic
1092764500 12:11840411-11840433 ATTAATTACTGAAGTACTCAAGG + Intronic
1094527485 12:31241741-31241763 ATTACCTTCTTATTTACTTCTGG - Intergenic
1094613307 12:32014299-32014321 ATTATTTACTGATTTGCTCATGG - Intergenic
1095649902 12:44595299-44595321 ATAAATTACTTTTTCACTCACGG - Intronic
1096789801 12:54037573-54037595 TTTACTTACTTATTTCCATAAGG - Intronic
1096808277 12:54153799-54153821 ATTACGTACTTATTTACTTAGGG + Intergenic
1097478763 12:60093815-60093837 ATTACTTTCTGCCTTACTCAGGG + Intergenic
1097982396 12:65747634-65747656 ATTAATGCCTTATTTACTCCAGG - Intergenic
1099411948 12:82341120-82341142 ACTTCTTAGTTATTTATTCAAGG - Intronic
1099521064 12:83663263-83663285 ATTACTTGAATTTTTACTCAAGG - Intergenic
1099848699 12:88063190-88063212 TTTATTTATTTATTTACTCAGGG - Intronic
1100005206 12:89887049-89887071 ATTATTTGCTTATTTAATCAAGG - Intergenic
1100444325 12:94647259-94647281 ATTACTTACATTTTCACTAAGGG + Intronic
1100717397 12:97320557-97320579 ATTACTTACATATTGAGACATGG + Intergenic
1100959592 12:99947622-99947644 ATTACAAACTTATTATCTCACGG + Intronic
1101065038 12:101012165-101012187 ATGATTTACTTATTTACTTGGGG + Intronic
1101669384 12:106853912-106853934 ATTACTTACTTTTTTATTTAAGG + Intronic
1102683476 12:114706040-114706062 ATTAGTTACTTAATAAGTCAGGG - Intergenic
1103484011 12:121270519-121270541 ATTACTTACTTGTTTTCTACTGG + Intronic
1104568985 12:129908801-129908823 ATTCAATACTTATTTATTCAGGG + Intergenic
1105490791 13:20886225-20886247 ATTTCTTACTTAATTGCTCTTGG - Intronic
1106401278 13:29433470-29433492 AATACTTATTGATTAACTCAAGG + Intronic
1107361469 13:39622424-39622446 ATTTCTTTCTGATTTAATCAAGG - Intergenic
1108158715 13:47615893-47615915 ATTACTTTCCTATTGCCTCATGG - Intergenic
1109887918 13:68566476-68566498 ATAACTTACTTATTGTCTCCAGG - Intergenic
1110420205 13:75299086-75299108 ATTACTTATTTACTTACTTCAGG + Intronic
1111073602 13:83203046-83203068 TTTATTTATTTATTTATTCATGG + Intergenic
1111423653 13:88051577-88051599 CTTACTTAAATATTTACTCTTGG - Intergenic
1111607192 13:90555784-90555806 ATTACTCACAGAGTTACTCAGGG - Intergenic
1112266052 13:97924819-97924841 TTTATTTATTTATTTAGTCAGGG + Intergenic
1112321507 13:98411987-98412009 ATTTCATACTAATTTTCTCAAGG + Exonic
1112587734 13:100734587-100734609 ATAACTTAATTATTTGCTCCAGG - Intergenic
1113453069 13:110426036-110426058 ATTATTTCCTTATTTGTTCAGGG - Intronic
1114922674 14:27352999-27353021 ATTATTTTCTTATGTATTCATGG + Intergenic
1115598559 14:34933427-34933449 TTTATTTATTTATTTACTAAAGG + Intergenic
1115626774 14:35201415-35201437 CTTATTTACTTATTTATTTATGG + Intronic
1115663238 14:35518467-35518489 CTTATTTACTTATTTAGACAGGG + Intergenic
1116144919 14:41053069-41053091 GTTATTTATTTATTTACTTATGG + Intergenic
1116604803 14:46977437-46977459 ATTACTTACTAATATAGTTAGGG - Intronic
1116668786 14:47814374-47814396 ATTTCTTACTGATTTAATCTAGG + Intergenic
1116734735 14:48674629-48674651 TTTATTTATTTATTTACTCCAGG - Intergenic
1117691019 14:58306107-58306129 ATTACTTAATTACTTACCCACGG - Exonic
1117707264 14:58483269-58483291 TTTATTTAGTTATTTATTCAAGG + Intronic
1118518649 14:66555237-66555259 ATAACATACATATTTACTTATGG + Intronic
1119248907 14:73135783-73135805 AATACTACCTTATTTAATCAAGG - Intergenic
1119651278 14:76385398-76385420 ATGAATTAATTTTTTACTCAGGG - Intronic
1119779303 14:77267539-77267561 TTTACTTACTTATTTATTCTGGG - Intronic
1120043584 14:79780606-79780628 ATTATTTATTTATTTATTTAGGG - Intronic
1120314129 14:82870606-82870628 ATAACTTACTTACTTATTAAAGG - Intergenic
1120420922 14:84284612-84284634 ACTACATACTCAGTTACTCAGGG - Intergenic
1120641441 14:87018493-87018515 ATTACATAGTTATTTAAGCATGG - Intergenic
1121719898 14:96101892-96101914 TTTACTTATTTATTTACAGACGG - Intergenic
1122400362 14:101463432-101463454 ATTACTCACAGATTTACCCAAGG + Intergenic
1123845690 15:24299371-24299393 TTTATTTATTTATTTACTCAGGG - Intergenic
1123864727 15:24507080-24507102 TTTATTTATTTATTTACTCAGGG - Intergenic
1126423475 15:48500564-48500586 TTTACTTATTTTTTTATTCAGGG - Intronic
1127239202 15:57092802-57092824 ATTACTTACTTTATTTCTTAAGG + Intronic
1128171338 15:65516700-65516722 ATTCCTTAATTTTTAACTCAAGG + Exonic
1131627483 15:94137289-94137311 AATACTTATTTATTTACTCAAGG - Intergenic
1134882961 16:17762190-17762212 ATGACTTAATTATTTCCTAAAGG - Intergenic
1135860158 16:26049135-26049157 ATTATTTCCTTATTTTCTAAAGG + Intronic
1137854493 16:51780260-51780282 ATTAATTAATTAATCACTCAGGG + Intergenic
1137885095 16:52094543-52094565 TTTACTTACTTACTTAGGCATGG - Intergenic
1139456520 16:67083175-67083197 ATTATTTATTTATTTCCTAAAGG - Intronic
1139664370 16:68446456-68446478 ACCACTTACTCATTTACTGATGG - Intronic
1139767074 16:69239548-69239570 TTTATTTATTTATTTAGTCAAGG + Intronic
1140381729 16:74494751-74494773 AATACTTACCTTTTCACTCATGG + Exonic
1140677625 16:77348830-77348852 GTTACCTCCTTATTTCCTCAGGG - Intronic
1141853402 16:86664234-86664256 ATTTCTACCTTATTGACTCAGGG + Intergenic
1146861118 17:36299830-36299852 ATTTCTTTCTTTTTTACACATGG + Intronic
1147091449 17:38103934-38103956 ATTTCTTTCTTTTTTACACATGG + Intergenic
1147105763 17:38216571-38216593 ATTTCTTTCTTTTTTACACATGG - Intergenic
1147676302 17:42208529-42208551 ATTACCTGCTTATCTACCCATGG - Intronic
1148423743 17:47571925-47571947 ATTTCTTTCTTTTTTACACATGG + Intronic
1149939186 17:60844853-60844875 TTTATTAACTTTTTTACTCATGG - Intronic
1150541657 17:66106578-66106600 ATTTCTTCCTTATTCACTCTTGG - Intronic
1150752291 17:67876038-67876060 TTTAATTACTTATGTACTAATGG + Intronic
1151044994 17:70909376-70909398 TTTATCTACTTATTTACTGAAGG - Intergenic
1153112335 18:1606983-1607005 ACTGGTTACTTATTTAATCAAGG - Intergenic
1153423284 18:4933042-4933064 ATTCCTTACAAATTTATTCAAGG - Intergenic
1153722307 18:7918123-7918145 TTTATTTACTTATTTATTGATGG + Intronic
1155379341 18:25201971-25201993 AATGCTTACTTATTTACTAAAGG + Intronic
1155580058 18:27294120-27294142 CTTACATACTTATTTACTAAAGG - Intergenic
1155610797 18:27665278-27665300 AAAACTTATTTATTTTCTCAGGG + Intergenic
1156995196 18:43457311-43457333 ATAACTTAGTGATTTATTCATGG - Intergenic
1157074603 18:44451419-44451441 ACTATTCACTTATTCACTCAGGG + Intergenic
1158470686 18:57734083-57734105 ATAACTTACCTATTAACTTAAGG - Intronic
1158616054 18:58988058-58988080 ATTCCTTACATTTTTTCTCAAGG + Intergenic
1159597746 18:70399173-70399195 CTTCCTCACTTATTTACTTAGGG + Intergenic
1161310987 19:3593886-3593908 TTTATTTACTTATTTACAGATGG + Intergenic
1162676749 19:12304846-12304868 ATTACTGACTTTTTTCATCATGG - Intergenic
1162768643 19:12935920-12935942 ATTATTTATTTATTTATTTAGGG + Intergenic
1163194394 19:15704623-15704645 ATTAATTATTAAGTTACTCAAGG + Intergenic
1164804365 19:31104889-31104911 ATTATTTATTTATTTACTTTTGG + Intergenic
1165539827 19:36483645-36483667 ATTATTTACCTATGGACTCATGG - Intronic
1166889108 19:45979492-45979514 TTTATTTATTTATTTACTGATGG + Intergenic
1166967291 19:46536788-46536810 CTTACTTGTTTATTTATTCATGG - Intronic
1167190194 19:47982710-47982732 TTTATTTACTCATTTGCTCACGG - Intronic
926651695 2:15353315-15353337 ATTACTTTCTTTCTTTCTCAAGG + Intronic
927731156 2:25472884-25472906 ATTATTTATTTATTTATTTAGGG - Intronic
928584067 2:32740656-32740678 CTTACTTACTTATTTAGAGATGG + Intronic
928808347 2:35189989-35190011 GTTATTTACTTATTTACACACGG - Intergenic
929026779 2:37612386-37612408 ATTTCTTACATGTTTACTCGTGG + Intergenic
929368926 2:41197109-41197131 ATGACTAAATTATTCACTCAAGG - Intergenic
930775194 2:55164005-55164027 ATTACCCATTTATTTACTGAAGG + Intergenic
931196703 2:60058587-60058609 AATATTTATTTATTTTCTCATGG + Intergenic
931259774 2:60607195-60607217 CTTCCTTCCTTATCTACTCAGGG + Intergenic
933373319 2:81445644-81445666 ATTACTTTCTCATTTAGACACGG + Intergenic
933402328 2:81814063-81814085 CTTTTTTACTTATTTACTCTGGG + Intergenic
936263857 2:110984803-110984825 TGTACTTATTCATTTACTCAAGG + Intronic
936386689 2:112036468-112036490 CTTACTGAATTATTTACTCCTGG - Intergenic
937945328 2:127329700-127329722 ATTCTTTATTTATATACTCAGGG - Intronic
939186861 2:138871388-138871410 ATCACTTACTTTTTTAAACAGGG - Intergenic
939669442 2:144992036-144992058 ATTACTGACTTTTGTATTCATGG + Intergenic
940082860 2:149824221-149824243 ATTCCTTACTTGCTTACTCAGGG - Intergenic
941511749 2:166419219-166419241 TTTAGTTACATATTTACTTAGGG + Intronic
943067033 2:183099307-183099329 ATTACTTATTTATTTGTTCCAGG + Exonic
943320667 2:186438688-186438710 ATTGCTTACTTTAATACTCAGGG - Intergenic
943867336 2:192943289-192943311 ATTATTTACTTCTTTAATCATGG + Intergenic
943904644 2:193482876-193482898 ATTACGTACTTTATTACTCATGG + Intergenic
944389578 2:199203594-199203616 ATTACTTTCTTCTTTCCTCCTGG + Intergenic
944776001 2:202965644-202965666 ATTACTTTTATATTTACTTATGG + Intronic
946461314 2:219871340-219871362 TTTACTTATTTATTTATTTATGG + Intergenic
947255054 2:228154146-228154168 ATTATTTATTTATTTACTTTTGG - Intronic
947344572 2:229177593-229177615 ATGAGTGACTTATTTATTCATGG + Intronic
1168819771 20:765034-765056 ATTACTTACATACATACGCATGG - Intronic
1169549127 20:6684155-6684177 ATTACTTACATAATAACTAAGGG - Intergenic
1170263266 20:14436238-14436260 ATCACTTTCTCATTTACTCTGGG - Intronic
1170371781 20:15656757-15656779 ATAACTAACTTATTTTCACAAGG + Intronic
1171299850 20:24050655-24050677 ATTACTCACTTTTTTATGCACGG + Intergenic
1172740417 20:37162123-37162145 CTTTCTTCCTTATTTTCTCAAGG + Intronic
1173541594 20:43856463-43856485 ATTATTTTCTTATTTACTTGTGG + Intergenic
1174890222 20:54383816-54383838 ATTACTTACTTTGTTAGTCAGGG - Intergenic
1177609498 21:23427386-23427408 ATTATTTGCTTATTTCCTTATGG + Intergenic
1178034753 21:28567347-28567369 AATAGTTACTCATTTAATCAGGG - Intergenic
1179221241 21:39409306-39409328 AACACTTATTTATTTTCTCATGG - Intronic
1179317955 21:40262073-40262095 ATTACTTCTTTATGTACACATGG - Intronic
1181364299 22:22363292-22363314 ATTTCTTACTTATTTACCCCTGG - Intergenic
1181560955 22:23699538-23699560 ATCACTTAAATATTTACTGAAGG + Intergenic
1181944520 22:26505719-26505741 TTTATTTATTTATTTATTCAGGG + Intronic
1182485711 22:30637287-30637309 TTTATTTACTTATTTAGACAGGG + Intronic
949696522 3:6702695-6702717 ATTTCTTCCTTATTTAATCTTGG - Intergenic
949729745 3:7094858-7094880 ATTACATCTTTATTTAATCAAGG + Intronic
949812260 3:8018285-8018307 ATAACTTACTTAGTTATTAAAGG + Intergenic
951125038 3:18974422-18974444 TTTACTTATTTATTTATTTAGGG + Intergenic
951779886 3:26350482-26350504 ATTGCTTATTTTTTTCCTCAGGG + Intergenic
954096040 3:48329083-48329105 ATTACTTGGTTTTTTCCTCAGGG - Intergenic
954562747 3:51571845-51571867 ATTATTTATTTATTTACTTTTGG + Intronic
955533749 3:59901295-59901317 ATTATTCACTCATTTACCCAAGG - Intronic
955558953 3:60168015-60168037 TTTACTTACTTATTGAGACAGGG - Intronic
956186114 3:66563636-66563658 AGTAATTTCATATTTACTCAGGG - Intergenic
956669731 3:71675447-71675469 TCTACTTGCTTATTTTCTCAAGG - Exonic
956738618 3:72258149-72258171 TTTATTCATTTATTTACTCAAGG + Intergenic
956871849 3:73426042-73426064 GTTACTTTCTTATTTACTACTGG + Intronic
956974914 3:74568177-74568199 ATTACTTAATGATTTAATGAAGG + Intergenic
957234491 3:77568015-77568037 ATCACTTACTTTATTACTAAAGG - Intronic
958457656 3:94351802-94351824 ATTAATTAGTTATTTATTAATGG - Intergenic
959108580 3:102094599-102094621 ATTACTTCTTTATTTACTTTAGG + Intergenic
959577246 3:107947702-107947724 TTTTCTTACTAATTTATTCAAGG - Intergenic
960203286 3:114864370-114864392 ATTTCTTATTTATTTAGCCAAGG + Intronic
960284410 3:115810899-115810921 AGTAATTACTTATTTGCTAATGG + Intronic
960289612 3:115867575-115867597 ATTACTTTCTTGTTTGCTCAGGG - Intronic
960308979 3:116097592-116097614 ATTACTTACTTATTTACTCATGG - Intronic
962044159 3:131737944-131737966 TGCATTTACTTATTTACTCAAGG + Intronic
962326141 3:134434016-134434038 ATTTATTAAATATTTACTCATGG - Intergenic
962398548 3:135038389-135038411 AGGACTTACATGTTTACTCAGGG - Intronic
963142365 3:141957310-141957332 CTTACTTACTTATTTAGAGACGG - Intronic
963844659 3:150143111-150143133 ATAACTTACTTACTTGCTCCAGG + Intergenic
964283277 3:155090254-155090276 ATTACTTAATTATTAATACAAGG + Intronic
964437441 3:156669386-156669408 TTTACTTATTTATTTAGACAGGG + Intergenic
964600515 3:158495906-158495928 ATTACTTTCTTATTTAAGCCAGG - Intronic
965291237 3:166884456-166884478 ATTTCTTCCTTATTTAATCTTGG - Intergenic
966640310 3:182182497-182182519 CTTACTTACATATTTACAGAAGG + Intergenic
970746487 4:19303574-19303596 ATTATTTATTTATTTACTATAGG - Intergenic
970970504 4:21977709-21977731 TTTATTTATTTATTTAATCAAGG - Intergenic
971543310 4:27850291-27850313 TTTAATTACATATTTTCTCAAGG - Intergenic
971729506 4:30359819-30359841 ATTATTTATTTATTTATTTAAGG + Intergenic
971829763 4:31675637-31675659 ATCACTTTCTTATTGACTTAGGG + Intergenic
972528830 4:39943349-39943371 ATTACTAATATATTTAGTCAAGG + Intronic
973069816 4:45844341-45844363 AGTATTTATTTATTTAGTCAGGG + Intergenic
973151208 4:46890407-46890429 ATTACCTAAATATTTACTGAGGG + Intronic
975290652 4:72674295-72674317 ATTTCTTACTGATTTAATCTAGG + Intergenic
975702519 4:77079975-77079997 ATATCTTATTTATTTTCTCAGGG - Intergenic
976249601 4:83036284-83036306 TTTATTTACTTATTTATTTACGG - Intronic
976264709 4:83179627-83179649 CTTATTTACTTATTTACATATGG + Intergenic
976341073 4:83945537-83945559 TTTGCTTATTTATTTCCTCAGGG + Intergenic
976964497 4:91019834-91019856 AAGATTTACTTATTTACTTATGG - Intronic
976975958 4:91166482-91166504 CATTATTACTTATTTACTCATGG - Intronic
977255376 4:94734538-94734560 ATTACTTTTTTATTTTCTGAAGG + Intergenic
977261312 4:94800394-94800416 ATTATTTAGATATTTACTTATGG + Intronic
977717965 4:100204778-100204800 TTTACTGACATATTTAGTCATGG + Intergenic
977783879 4:101010059-101010081 TTTAATAACTTATTTACTGAAGG + Intergenic
977843144 4:101733994-101734016 ATTATTTGCTTCTTTACTAAAGG + Intronic
978239063 4:106493918-106493940 ATTACATACCAATTTACTGAGGG - Intergenic
980020192 4:127699943-127699965 ATTAGTTACTTTTTTAGTAATGG - Intronic
980024631 4:127750418-127750440 ATTATTTCCTTATAAACTCATGG + Intronic
980500938 4:133652920-133652942 ATTACTTATTTTATTACTAAAGG + Intergenic
981555832 4:145992479-145992501 TTTACTCACTCATTTACTGAAGG + Intergenic
981598736 4:146459359-146459381 TTTATTTATTTATTTATTCAGGG + Intronic
981904279 4:149903228-149903250 ATTATTTATTTATTTATTTAGGG - Intergenic
983329387 4:166304956-166304978 ATTTCTTCCTTATTTAATCTGGG - Intergenic
984440341 4:179761582-179761604 CTGACTTTCTTACTTACTCATGG + Intergenic
984496862 4:180509229-180509251 ATTAATTTCTTATTTTATCAAGG - Intergenic
984636637 4:182118151-182118173 ATTAATTACTTATTAATTCCAGG + Intergenic
984682583 4:182626883-182626905 ATGACTTACTTATTTTAACAGGG - Intronic
984823430 4:183904626-183904648 ATTATTTATTTATTTACCCTGGG + Intronic
986925083 5:12737757-12737779 ATTACTTGCTTATTTAATAAAGG - Intergenic
987941862 5:24549290-24549312 ATTTCTTACCTATTTCCTCTTGG - Intronic
988860350 5:35271035-35271057 TTCATTTACTTATTTATTCATGG - Intergenic
989965296 5:50460000-50460022 ATTACGTACATATTGAATCAAGG + Intergenic
992007450 5:72491815-72491837 GTTTCTTATTTATTTACTCAAGG + Intronic
993778319 5:92030951-92030973 ATTAACTATTCATTTACTCAAGG - Intergenic
993877505 5:93325563-93325585 ATTATTTCCTTACTCACTCATGG + Intergenic
993891469 5:93479768-93479790 GTCATTTACTTATTTACTCATGG - Intergenic
994556064 5:101305287-101305309 ATTACTTACTTAAATATTCATGG + Intergenic
994636337 5:102348787-102348809 ATTTCTTCCTTATTTAATCTAGG - Intergenic
994814447 5:104567502-104567524 ATTCCTGACTGATTTACTAATGG + Intergenic
995351485 5:111181260-111181282 AATACTGATTTATTTATTCAGGG - Intergenic
995409082 5:111834171-111834193 ATTAAATACTTAATTACTCATGG - Intronic
995551898 5:113289788-113289810 ATAACCATCTTATTTACTCATGG - Intronic
996177293 5:120374708-120374730 ATTAGTTAATAATTTACTTAGGG + Intergenic
996661290 5:126006259-126006281 ATTACTTATTTAATTATTAAAGG - Intergenic
996973038 5:129396106-129396128 CTTACTTCCCTATTTACTCCTGG + Intergenic
998952779 5:147408568-147408590 ATTCCTTTCTAATTTTCTCACGG + Intronic
1000267953 5:159656547-159656569 TTTACCTACTTGTTTACTTATGG + Intergenic
1000689905 5:164304540-164304562 AAGACTTACTGACTTACTCAGGG + Intergenic
1000910210 5:167012908-167012930 CTTACATGCTTATTTACTCAAGG - Intergenic
1001692500 5:173643543-173643565 ATTACTTATTAATTCACTCATGG + Intergenic
1002154741 5:177267802-177267824 ATGATCTACTTAATTACTCATGG + Intronic
1003411388 6:5865884-5865906 AGTTCTTACTTAGTAACTCAGGG - Intergenic
1004655828 6:17659427-17659449 ATAAATTCCTTATTTACACAAGG + Intronic
1006322755 6:33329997-33330019 TTTACTTATTTATTTACAGACGG + Intergenic
1006752797 6:36389152-36389174 CATAGTTACTTATTTAATCATGG + Intergenic
1008226684 6:48927527-48927549 AGTACATACTCATTTACTCAAGG - Intergenic
1009267337 6:61572254-61572276 ATTTCTTCCTTATTTAATCTAGG - Intergenic
1009603093 6:65828696-65828718 ACCACTTATTTATTTACTCATGG - Intergenic
1010579653 6:77579204-77579226 ATTATTTAACTATTTACTCTGGG + Intergenic
1011979654 6:93357062-93357084 CTTATTTACTTATTTATTCTTGG - Intronic
1012629366 6:101444244-101444266 ATTATTTTCTTTTTTTCTCAAGG + Intronic
1012707585 6:102551754-102551776 ATTTAATACTTATGTACTCAGGG + Intergenic
1012827107 6:104160543-104160565 AAAACTAACTAATTTACTCAAGG - Intergenic
1012977617 6:105796791-105796813 AATACTAAGTCATTTACTCAAGG - Intergenic
1013161878 6:107552922-107552944 ACTATTTATTTATTTATTCATGG - Intronic
1013440362 6:110158646-110158668 ATTACTCACTTATTTTATCTTGG - Intronic
1013726434 6:113102650-113102672 TTCACTTACTTTTTTACTCTTGG + Intergenic
1013851758 6:114524548-114524570 ATTACTAAATTATTTACTATGGG - Intergenic
1014040962 6:116824529-116824551 ATTTCTTCCTTATTTAATCTTGG - Intronic
1014248405 6:119092135-119092157 CTTATTTACTTATTTACTTGGGG + Intronic
1014504342 6:122235105-122235127 ATTGTTTTCTTTTTTACTCAAGG - Intergenic
1015470244 6:133597239-133597261 TTTATTTACTTATTTAATTATGG + Intergenic
1016800869 6:148167762-148167784 AATATTCACTTATTTATTCACGG + Intergenic
1017263152 6:152411344-152411366 TTTACTTACTTATTTATTTTAGG + Intronic
1018025375 6:159801378-159801400 AATACTGACTTATTTAAGCACGG - Intronic
1018522944 6:164672502-164672524 ATTACTTCCTTATCTAATGAAGG - Intergenic
1018530601 6:164758971-164758993 TTTATTTACTTTTTTATTCAGGG + Intergenic
1021388003 7:20055815-20055837 ATTACTTCCTGATTTAATCTAGG - Intergenic
1022590669 7:31658997-31659019 AGTAATTGCTTATTTGCTCAGGG + Intergenic
1022623279 7:32007076-32007098 CATACTCACTTATTTAGTCATGG - Intronic
1023118613 7:36886849-36886871 ATCACTTACATAATTTCTCAAGG - Intronic
1023361432 7:39420063-39420085 ATTACTTGCAGATTTACTGAAGG - Intronic
1023763557 7:43489362-43489384 TTTATTTATTTATTTATTCATGG + Intronic
1024936155 7:54714183-54714205 CTCCCTTTCTTATTTACTCAGGG + Intergenic
1026391615 7:69908406-69908428 ATAACTTTGTTATTTACTCTGGG + Intronic
1028499742 7:91506335-91506357 AATACTTACTTATATGTTCATGG + Intergenic
1028857921 7:95613056-95613078 CTTTCTTACTTATTTCATCAAGG - Intergenic
1029544412 7:101202640-101202662 CTTATTTACTTATTTATTTAGGG + Intergenic
1030269249 7:107652722-107652744 TTTATTTATTTATTTACTTAGGG + Intergenic
1030928406 7:115487403-115487425 ATTGCTAGCTTATTTATTCATGG - Intergenic
1031369675 7:120949662-120949684 ATTACATACTCTTGTACTCAAGG - Intergenic
1031411680 7:121447235-121447257 ATTATTTACTTCTTTTCTCTAGG + Intergenic
1031678578 7:124642087-124642109 ATTAATTACTTTTTTAGACACGG - Intergenic
1033630933 7:143157065-143157087 ATTATTTATTTATTTATTTATGG - Intergenic
1033725121 7:144107706-144107728 ATTATTTACTCATTTACTCCTGG + Intergenic
1033865924 7:145690524-145690546 ATAACTTACTTAATTATTAAAGG - Intergenic
1034727178 7:153347657-153347679 GTTACTTACGTAGTTACTCAAGG - Intergenic
1035541259 8:440158-440180 CTTTCTTATTTATTTACTCAGGG + Intronic
1035581576 8:743568-743590 TTTACTTACTTATTTAGAGACGG + Intergenic
1036959794 8:13231494-13231516 ATTACTTCCTAATTTACAAAAGG + Intronic
1037008198 8:13807373-13807395 TTTTCTTACTTATTTTTTCAAGG + Intergenic
1037245421 8:16829502-16829524 TTTACTTATTTATTTAGACATGG + Intergenic
1038387446 8:27162381-27162403 ATTACTTACCTATGTTCCCATGG - Intergenic
1039027208 8:33270830-33270852 ATTACTTATTTATTTATTTGGGG - Intergenic
1039028453 8:33283846-33283868 ATTACTGACTTATTGTCTCATGG - Intergenic
1039723987 8:40195574-40195596 ATGACTAATTTATTTACTTAGGG - Intergenic
1039763618 8:40604927-40604949 ATTTCTTACTTGTTTAATCTAGG + Intronic
1041006140 8:53498418-53498440 ATTACTTGCTTCTTTCCCCAGGG + Intergenic
1041718708 8:60956601-60956623 TTTTCTTACTTTTTTGCTCATGG + Intergenic
1041813070 8:61933830-61933852 ATCAATTACTTATCTTCTCAAGG + Intergenic
1042834120 8:73062601-73062623 ATTACTTATTTATTTAGAGATGG - Intergenic
1042854302 8:73250348-73250370 ATTACTTACATATAAATTCAGGG + Intronic
1043493597 8:80775655-80775677 TTTACTTCTTAATTTACTCAGGG + Intronic
1044146916 8:88728196-88728218 ACTAATTACATATTTACTTAAGG - Intergenic
1044464879 8:92491301-92491323 TTTATTTACTTATTTACTGTAGG + Intergenic
1044721152 8:95149365-95149387 ATTACCTATTTATTTATTTATGG + Intronic
1044975754 8:97663804-97663826 ATTATTTCCTTATTTTCACAAGG + Intronic
1045879639 8:107022746-107022768 ATCACATACTTATTTACTTTAGG - Intergenic
1046245708 8:111559112-111559134 ATAATTTACTTTTTTATTCATGG + Intergenic
1046925343 8:119781024-119781046 TTTACTTTCTAATTTTCTCATGG - Intronic
1047206606 8:122807344-122807366 ATTACATATTTGTTGACTCAGGG + Intronic
1047992791 8:130303988-130304010 ATTACCTAATTATTAACTAATGG + Intronic
1048642680 8:136381871-136381893 TTTATTTACTTGTTTACTAATGG + Intergenic
1050809084 9:9720439-9720461 TTTACATTCTTATTTACTTAAGG + Intronic
1051770893 9:20578189-20578211 CTTACATTCTTATTTAGTCAAGG - Intronic
1055327363 9:75144803-75144825 TTTACTTATTTATTTACTTATGG + Intronic
1056604051 9:88070741-88070763 ATTTCTTCCTTATTTAATCTAGG - Intergenic
1057358751 9:94354188-94354210 ATTACTTACTCATTTACCAGTGG - Intergenic
1057543553 9:95999563-95999585 ATTATTTACGTGTTTACTCTGGG - Intronic
1057608599 9:96520356-96520378 TTTACTTATTTATTTAGACAGGG + Intronic
1057649003 9:96903422-96903444 ATTACTTACTCATTTACCAGTGG + Intronic
1057731808 9:97615860-97615882 ATTATTTATTTATTTACACCAGG + Intronic
1058385505 9:104430528-104430550 ATTTCTTATTTATTTACATATGG + Intergenic
1059298127 9:113290679-113290701 ATTTCTAAATTATTTTCTCAGGG + Exonic
1061657832 9:132106437-132106459 ATGACTTATGTATTTATTCAGGG + Intergenic
1186052215 X:5609315-5609337 TTTATTTATTTATTGACTCAGGG + Intergenic
1186761125 X:12723051-12723073 AATACTTAACTATTTACTCATGG - Exonic
1187806243 X:23124386-23124408 ATTATTTTATTTTTTACTCAGGG - Intergenic
1188134047 X:26472184-26472206 ATTTCTTTCTTTTTTTCTCATGG + Intergenic
1188914698 X:35895987-35896009 ATTACTTCCTTATTTATACCAGG - Intergenic
1188952058 X:36388504-36388526 AATACTTATCAATTTACTCATGG + Intergenic
1189662988 X:43323249-43323271 ATTTCTTCCTTATTTAATCTAGG + Intergenic
1192611201 X:72569110-72569132 TTTACTTACCTATAAACTCAAGG - Intronic
1193617403 X:83706551-83706573 ATTTCTTACTGATTTAATCTAGG + Intergenic
1193689769 X:84626646-84626668 ATTACTTCCTGATTTAATCTAGG + Intergenic
1194224659 X:91241547-91241569 ATTTCTTACTGATTTAATGAAGG + Intergenic
1194277665 X:91906779-91906801 ATTACTTAATTAATTAATTATGG + Intronic
1194896027 X:99441118-99441140 ATTACTCACTTAAATACGCATGG - Intergenic
1196061778 X:111415769-111415791 ATTAATTACATATTTCCTGAAGG + Intergenic
1196885600 X:120242648-120242670 ATTTTTTACTTCTTTATTCAGGG + Intergenic
1197416020 X:126173907-126173929 CTTACTTAGTTATTTTCACAGGG + Intergenic
1197500695 X:127238220-127238242 ATTTCTTAATTATCTACTCTAGG - Intergenic
1199263886 X:145807524-145807546 ACTACCTACATATTTACTCATGG - Intergenic
1200539061 Y:4436835-4436857 CTTAATTTTTTATTTACTCAAGG + Intergenic
1200561121 Y:4704857-4704879 ATTTCTTACTGATTTAATGAAGG + Intergenic
1200595007 Y:5128854-5128876 ATTACTTAATTAATTAATTATGG + Intronic