ID: 960308979

View in Genome Browser
Species Human (GRCh38)
Location 3:116097592-116097614
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 356}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960308979_960308983 23 Left 960308979 3:116097592-116097614 CCATGAGTAAATAAGTAAGTAAT 0: 1
1: 0
2: 2
3: 43
4: 356
Right 960308983 3:116097638-116097660 TAGAAAATGGCTCTACTGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 142
960308979_960308980 -8 Left 960308979 3:116097592-116097614 CCATGAGTAAATAAGTAAGTAAT 0: 1
1: 0
2: 2
3: 43
4: 356
Right 960308980 3:116097607-116097629 TAAGTAATGAGACTGTCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 160
960308979_960308981 10 Left 960308979 3:116097592-116097614 CCATGAGTAAATAAGTAAGTAAT 0: 1
1: 0
2: 2
3: 43
4: 356
Right 960308981 3:116097625-116097647 TCAGGACTACCATTAGAAAATGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960308979 Original CRISPR ATTACTTACTTATTTACTCA TGG (reversed) Intronic