ID: 960308981 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:116097625-116097647 |
| Sequence | TCAGGACTACCATTAGAAAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 169 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 156} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 960308978_960308981 | 11 | Left | 960308978 | 3:116097591-116097613 | CCCATGAGTAAATAAGTAAGTAA | 0: 1 1: 0 2: 7 3: 60 4: 609 |
||
| Right | 960308981 | 3:116097625-116097647 | TCAGGACTACCATTAGAAAATGG | 0: 1 1: 0 2: 0 3: 12 4: 156 |
||||
| 960308979_960308981 | 10 | Left | 960308979 | 3:116097592-116097614 | CCATGAGTAAATAAGTAAGTAAT | 0: 1 1: 0 2: 2 3: 43 4: 356 |
||
| Right | 960308981 | 3:116097625-116097647 | TCAGGACTACCATTAGAAAATGG | 0: 1 1: 0 2: 0 3: 12 4: 156 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 960308981 | Original CRISPR | TCAGGACTACCATTAGAAAA TGG | Intronic | ||