ID: 960311351

View in Genome Browser
Species Human (GRCh38)
Location 3:116120205-116120227
Sequence AAGGTATCTTGATGGACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960311348_960311351 16 Left 960311348 3:116120166-116120188 CCAAGAAATTTCAAATAAGATAT 0: 1
1: 1
2: 2
3: 57
4: 677
Right 960311351 3:116120205-116120227 AAGGTATCTTGATGGACCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960311351 Original CRISPR AAGGTATCTTGATGGACCAA AGG Intronic
905369090 1:37473782-37473804 AAAGCATCTTCATGGAGCAAGGG + Intergenic
911447865 1:98021365-98021387 ATGGTAGCTTGATCGTCCAACGG + Intergenic
912122964 1:106496153-106496175 AAAGAATACTGATGGACCAAAGG + Intergenic
913136759 1:115898291-115898313 AAGGTCTGGTGATGGAGCAAGGG - Intergenic
914433301 1:147639254-147639276 AAGGTAACATTATGGAACAATGG - Intronic
915877114 1:159622824-159622846 AGGGTATCTGGGTGCACCAAGGG - Intergenic
917112753 1:171567353-171567375 AAGATATGTTGATTGACCATGGG + Intronic
1064863217 10:19850030-19850052 AAGGTAATTTGATTGACCTAAGG + Intronic
1068817310 10:61332191-61332213 AAGATGCCTTGATGTACCAATGG - Intergenic
1071403140 10:85298174-85298196 AAGGTATTTCTATGGAGCAATGG - Intergenic
1074441860 10:113484667-113484689 AAGGAATCTTGCTCAACCAAGGG + Intergenic
1075197659 10:120375122-120375144 AAGGGGTCTTGATGGACCCCTGG - Intergenic
1075236451 10:120735351-120735373 AAAGTATCTTTCAGGACCAAAGG + Intergenic
1076825132 10:132963406-132963428 AAGGGATGTTGATGGACGGATGG - Intergenic
1088854747 11:113738120-113738142 AAGGTATCTAGATTTTCCAAAGG + Intronic
1097647451 12:62253306-62253328 AAAGTATGTGGATGGACCTATGG - Intronic
1097720039 12:63010560-63010582 AAGGGAGCTTCCTGGACCAAAGG + Intergenic
1101858072 12:108460730-108460752 CAGGTATTTTGGTAGACCAAGGG - Intergenic
1103176478 12:118867923-118867945 AAGTTAACTTACTGGACCAAGGG - Intergenic
1103214994 12:119195143-119195165 ACTGTATCTGGATGGGCCAAAGG + Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1104121586 12:125805137-125805159 GAGGTACATTGATGGAACAATGG + Intergenic
1104827587 12:131724639-131724661 AATGGATCTTGTTAGACCAAAGG - Intronic
1106823669 13:33494017-33494039 CAGGTATCTTGATGAACACAGGG - Intergenic
1109405018 13:61886532-61886554 ATGGTATATTGTTGAACCAATGG + Intergenic
1110173919 13:72534409-72534431 AAGGTATCTCGAGAGACCAAGGG + Intergenic
1110777142 13:79421250-79421272 AAGGTTTATAGATGGCCCAAAGG + Intergenic
1110901126 13:80826039-80826061 AAGGTATATACATAGACCAATGG - Intergenic
1111399971 13:87721399-87721421 GAGGTATGTGGATGGACCTATGG + Intergenic
1111875121 13:93883261-93883283 AAGGAAGCTTGCTGGATCAAAGG + Intronic
1111875238 13:93885226-93885248 AAGGAAGCTTGCTGGATCAAAGG - Intronic
1120351477 14:83365431-83365453 AAGTTATCTTCATGAACCAGAGG - Intergenic
1128113452 15:65090740-65090762 AAGGTATCTGGCTGGAGCAGAGG - Intergenic
1128837894 15:70826003-70826025 AAGGTAGCTTGGTTCACCAATGG + Intergenic
1130813128 15:87403379-87403401 AAGCTCTCTTGATGGAAGAATGG + Intergenic
1132219097 15:100091711-100091733 AAGGTACCATGATGGACTAGAGG + Intronic
1134541528 16:15070702-15070724 AAGGTATCTTTATGGGCCACTGG + Intronic
1135905281 16:26506472-26506494 AAGGTATCTTGAGGGCAGAAGGG + Intergenic
1136027742 16:27480849-27480871 AAGGAAGCCTGAAGGACCAATGG + Intronic
1144850331 17:18240938-18240960 AGGGTTTCTTGAGGGTCCAATGG - Intronic
1147884357 17:43674867-43674889 CAGGTGTCTGGATGGACCAGGGG + Intergenic
1151877083 17:76872961-76872983 AAGGTACCTTGGTGGGGCAAGGG + Exonic
1158084801 18:53638406-53638428 AAGGTATTTTGATGCAGCATAGG - Intergenic
1158891025 18:61871768-61871790 GAGGTAACTTGATAGACCAAGGG - Intronic
1165660498 19:37575669-37575691 AAGACATCTTGGTGGACTAATGG + Intronic
1166268045 19:41696977-41696999 AAGGAATCCTGAGGGACAAAGGG - Intronic
924979271 2:206241-206263 AAGGTATCTCTATGTAGCAACGG + Intergenic
928349180 2:30531603-30531625 AAAGTAACTTAATGGACCTATGG + Intronic
929268954 2:39951789-39951811 AAGAAATCTTGAGGAACCAAGGG + Intergenic
930003792 2:46880300-46880322 CAGGTATTTTGGTGGACCAGGGG + Intergenic
931849096 2:66235055-66235077 AAGATATCTGCATGGCCCAACGG - Intergenic
933551269 2:83779580-83779602 AAGGTATCTTGTTTGATGAATGG + Intergenic
935562459 2:104573369-104573391 AAGATATCTTGATTGACAGATGG + Intergenic
936430471 2:112458217-112458239 GAGGTATATTGTTGGACCTATGG + Intergenic
945605802 2:211928586-211928608 AATGTATCTTGAAGGCCCGATGG - Intronic
945962054 2:216145952-216145974 CAGGTATTTTAATGAACCAAGGG + Intronic
947722439 2:232378223-232378245 AAGGTAAGATGATGGAGCAAGGG + Intergenic
1178301516 21:31457415-31457437 AAGGAATCTTGAGGGACCTTTGG - Intronic
952576076 3:34775694-34775716 AAGGCATCTGCATGGGCCAAGGG + Intergenic
952921502 3:38287693-38287715 AATGTATATTGAAGGACAAAGGG - Intronic
957514497 3:81233022-81233044 GAGGCATGTTGATGGACCCATGG - Intergenic
958619468 3:96538191-96538213 AAGATATCCTGATGGCCAAAAGG + Intergenic
960107463 3:113813726-113813748 AAGGCATCTTGTTGGATCAATGG + Intergenic
960311351 3:116120205-116120227 AAGGTATCTTGATGGACCAAAGG + Intronic
963278786 3:143360095-143360117 TAGGTATCTTGATGGACTTTAGG + Intronic
964050456 3:152386641-152386663 CAGGTATCTTGACACACCAACGG - Intronic
976493971 4:85704888-85704910 AAGGTACTTTGATTGACCAAGGG + Intronic
977117412 4:93048028-93048050 AAAGTATATTGATGGCCCATAGG + Intronic
979283592 4:118895586-118895608 CTGGTATCTTGATGAACCAATGG - Intronic
979884340 4:126005837-126005859 AAGGTATGTTTATGGTCCCAAGG + Intergenic
983130857 4:164017936-164017958 TAGGTATATGGATGGACAAATGG + Intronic
986122570 5:4855448-4855470 AAGGTAACTTGAAGGACACAGGG + Intergenic
989477520 5:41891284-41891306 AAGGTTTCTTGATTGACAATTGG - Intergenic
990346660 5:54878336-54878358 ATGGTATATTGATAGACCCAGGG - Intergenic
991104554 5:62829579-62829601 AAGTTATATTGATGGAAAAATGG - Intergenic
993805118 5:92397625-92397647 AAAGTACCTTGATGGATCATTGG + Intergenic
994511467 5:100709226-100709248 AAAGTATCATGATGGATTAATGG + Intergenic
999167720 5:149564880-149564902 AAGGTATGTTAATGAACCCATGG + Intronic
1010406980 6:75516782-75516804 ATGGTAACTTGGTGGACCAAGGG + Intergenic
1015014228 6:128390983-128391005 AAGCCATCTTGATGGAGCCAGGG + Intronic
1016708719 6:147144412-147144434 AAGGTAGCATGATGGACGATAGG + Intergenic
1031778577 7:125933808-125933830 GATGTAACTTGATGGACAAATGG + Intergenic
1032965229 7:137089059-137089081 AGGGTATCTTGAAGGTCGAAAGG - Intergenic
1039990171 8:42481079-42481101 AAAGTATCTTGATGGTGCCAAGG + Intronic
1045865313 8:106858437-106858459 AAGGCATCTTGATACACCAGAGG - Intergenic
1046556449 8:115779310-115779332 GAGCTTTCTTGATGGGCCAAAGG - Intronic
1046878484 8:119281783-119281805 AATCTATATTGATGGTCCAAGGG - Intergenic
1050073168 9:1837795-1837817 GAGGTAGCTTAATGGGCCAAGGG - Intergenic
1057979039 9:99639626-99639648 AAGGTATATTGATGTACCTTGGG - Intergenic
1062047537 9:134431434-134431456 AAGGTATCTTCCTGGACTGAAGG + Intronic
1190009193 X:46768720-46768742 AAGGTATCTTGATGCATTTAGGG - Intergenic
1190434018 X:50405731-50405753 AAGCTATTTTGATGAACTAAAGG + Intronic
1192544532 X:72002665-72002687 AAGGTTTCCTCATGGAACAAAGG - Intergenic
1197027685 X:121774668-121774690 AAAGTAGATTAATGGACCAATGG - Intergenic