ID: 960312463

View in Genome Browser
Species Human (GRCh38)
Location 3:116133173-116133195
Sequence TTTCCTAGGTTGTGCACCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960312463_960312465 2 Left 960312463 3:116133173-116133195 CCTCAGGTGCACAACCTAGGAAA 0: 1
1: 0
2: 0
3: 14
4: 155
Right 960312465 3:116133198-116133220 TTGAGCAGTTAGCTTAAACTTGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960312463 Original CRISPR TTTCCTAGGTTGTGCACCTG AGG (reversed) Intronic
900017377 1:162022-162044 CTTCCTAGGTAGTGGATCTGAGG + Intergenic
900047636 1:520618-520640 CTTCCTAGGTAGTGGATCTGAGG + Intergenic
900069851 1:762486-762508 CTTCCTAGGTAGTGGATCTGAGG + Intergenic
900768731 1:4523574-4523596 TTTCCTAGAGTGAACACCTGAGG - Intergenic
901107776 1:6770721-6770743 TTTCCTAGGATGTGTACTTCCGG + Intergenic
902132912 1:14279370-14279392 TTACCTAGGATGTGCACATGAGG - Intergenic
902740801 1:18436664-18436686 ATTCCTGGCTTGGGCACCTGTGG - Intergenic
903458519 1:23504840-23504862 TTTCCTAGGCAGAGGACCTGCGG - Intergenic
904070218 1:27790015-27790037 ATCCATAGGTTCTGCACCTGTGG + Intronic
910061375 1:83097027-83097049 TTTCCTATGTTGTGATCCTAAGG + Intergenic
911828532 1:102519803-102519825 TTTACCAGGTTGAGCAGCTGGGG - Intergenic
912174871 1:107142008-107142030 TATCCCATGTTGTGCAGCTGGGG + Intronic
912457527 1:109807773-109807795 TTTGCTAGGTTCTGCCCCTGAGG - Intergenic
912486091 1:110029664-110029686 TGTCCTGGGTTGTGGCCCTGAGG + Intergenic
916056216 1:161070271-161070293 TTTCCTAGGTTTGGAAACTGAGG - Intergenic
917283095 1:173397745-173397767 TTTCCTAGGTAGTAAACCTGGGG - Intergenic
917317349 1:173739563-173739585 TTTTCTAGTTTGTGCACATAAGG + Intronic
918920151 1:190698544-190698566 TTTACTAGGCTGTGCCCCAGTGG - Intergenic
920159080 1:203982013-203982035 CCTCCTAGGTTCTGCAGCTGGGG + Intergenic
922105224 1:222507954-222507976 CTTCCTAGGTAGTGGATCTGAGG + Intergenic
922265534 1:223980474-223980496 CTTCCTAGGTAGTGGATCTGAGG + Intergenic
922364413 1:224850699-224850721 TTTCTTTGGTTGTGAATCTGTGG + Intergenic
924347394 1:243085473-243085495 CTTCCTAGGTAGTGCATCTGAGG + Intergenic
1063340562 10:5259406-5259428 ATTCCAAGGATGTGCACGTGAGG + Intergenic
1064051805 10:12066178-12066200 ATTCCTTGGTTGTGAACCTGTGG - Intergenic
1066728958 10:38419401-38419423 CTTCCTAGGTAGTGGATCTGAGG - Intergenic
1072056444 10:91762230-91762252 TTTTCTAGTTTGTGCACATAGGG - Intergenic
1072820510 10:98551918-98551940 ATTCCTAGGCTGTTCCCCTGGGG - Intronic
1072964040 10:99955963-99955985 CTTGCTAGGTTGTGGAGCTGAGG + Exonic
1073950614 10:108804716-108804738 TTTCCTAGGTTGGGTCACTGAGG - Intergenic
1075362853 10:121854963-121854985 TTCTCTTGGTTGTGCAACTGTGG - Intronic
1076973978 11:157250-157272 CTTCCTAGGTAGTGGATCTGAGG + Intergenic
1077474561 11:2780244-2780266 TTTCCTAGGGTCTGTCCCTGAGG - Intronic
1081497383 11:43629105-43629127 TTTCCTAGAAAATGCACCTGGGG - Intronic
1084358315 11:68653655-68653677 TTTCATTGGTTGTGCCCTTGGGG - Intergenic
1086010784 11:82100920-82100942 TTTCCTCTATTTTGCACCTGTGG - Intergenic
1089207462 11:116775974-116775996 TTTCCTTCTTTGTACACCTGTGG - Intergenic
1094664767 12:32508123-32508145 GTTCCTCGGCTGTGCACGTGAGG + Intronic
1096495374 12:52036890-52036912 CTTCCGAGGCTGGGCACCTGGGG - Intronic
1099132837 12:78858067-78858089 TTACCTTGGTTGTGCAGCTAGGG + Intergenic
1100961308 12:99965624-99965646 TGGCCCAGGTTGTGCACCTTTGG - Intronic
1102220586 12:111191770-111191792 TTTCCTCTGTTCTCCACCTGGGG + Intronic
1106212813 13:27666462-27666484 TTTCCTACATTGTTCACCTAAGG - Intronic
1106582503 13:31030550-31030572 TTTCTCAGGATGTCCACCTGAGG + Intergenic
1108065960 13:46577902-46577924 TCTCCTTGGTTCTGCTCCTGTGG + Intronic
1109983409 13:69941835-69941857 TTTTCTAGTTTGTGCACATAAGG - Intronic
1111440711 13:88280210-88280232 ATTCCTTGGTTGTCCACCTATGG - Intergenic
1112951641 13:105004903-105004925 TTTCCTAAGTTGTGCTAGTGAGG + Intergenic
1115037612 14:28878724-28878746 TTTGCTAGGTTGTGTTCTTGTGG + Intergenic
1119142996 14:72284676-72284698 TTCCCTAGGCAGTGCCCCTGTGG - Intronic
1121694888 14:95904449-95904471 TTGCCTTGGCTGTGCTCCTGAGG - Intergenic
1122366612 14:101198258-101198280 GTGCCCAGGTTGTACACCTGGGG + Intergenic
1122915423 14:104856146-104856168 TTTCTCAGCCTGTGCACCTGGGG - Intergenic
1122991042 14:105236812-105236834 GATGCTAGGTTGTGCTCCTGAGG - Intronic
1127691167 15:61399112-61399134 TTCCCCAGGTTTTGCTCCTGCGG + Intergenic
1133068543 16:3228930-3228952 ATTCATAGGTTCTGCATCTGAGG + Intronic
1133632208 16:7631764-7631786 TTTCCTAAATTGTGAAGCTGAGG + Intronic
1134690414 16:16187524-16187546 TTTCAAATGTTGTCCACCTGGGG + Intronic
1135878509 16:26228708-26228730 TTTCTTAGGTACTGCTCCTGTGG - Intergenic
1140733264 16:77875293-77875315 TTTCCTAGTTAGTGAAACTGTGG + Intronic
1141506767 16:84483190-84483212 TTTCGTAGGCCGTGCCCCTGGGG - Intronic
1141522371 16:84589616-84589638 CTTCCAAGGTTGTTCACTTGGGG - Intronic
1142446285 16:90140435-90140457 CTTCCTAGGTAGTGGATCTGAGG - Intergenic
1142461220 17:95028-95050 CTTCCTAGGTAGTGGATCTGAGG + Intergenic
1143375434 17:6464302-6464324 ATTACTAGGATGTCCACCTGCGG + Exonic
1147576507 17:41603303-41603325 TTTCCAAGGATCTGCTCCTGGGG + Intergenic
1148027416 17:44598395-44598417 TTTCCTCTGCTGTGCCCCTGAGG + Intergenic
1148098461 17:45071640-45071662 TTTCTTATGTTGTAAACCTGTGG + Intronic
1149686805 17:58540450-58540472 TTTGCCAAGCTGTGCACCTGTGG - Intronic
1155077135 18:22368972-22368994 TCTTCTTGGTTGTGCACCTCTGG - Intergenic
1155800546 18:30097295-30097317 TTTCCTAGATTTAGCACTTGAGG - Intergenic
1156439852 18:37173917-37173939 TTTCCTAGGTTTGGCTTCTGTGG - Intronic
1158305060 18:56096082-56096104 CTTCCTAGGTTCTGCCACTGTGG - Intergenic
1159831676 18:73284985-73285007 GTTGGTAGGTTCTGCACCTGTGG + Intergenic
1160425300 18:78774920-78774942 GGTCCTCGGTTGTGCACCGGGGG - Intergenic
1164500062 19:28811635-28811657 GTTCCTGGACTGTGCACCTGTGG - Intergenic
1167136260 19:47617976-47617998 TTTCATAGGTTGGGAAACTGAGG + Intronic
1167660994 19:50796022-50796044 TTTCCGAGGCTGTGCGCCTCTGG + Intergenic
1168578699 19:57535375-57535397 TTTCCTTGGTTCTTGACCTGTGG + Intronic
925351639 2:3205126-3205148 TGTCCCAGGTTGTGCACCCTGGG + Intronic
930463751 2:51717730-51717752 ATTCATAGCTTCTGCACCTGTGG + Intergenic
930539901 2:52692077-52692099 TTTCCTATTTAGTGCATCTGAGG + Intergenic
931163266 2:59717444-59717466 TATCCCAGGAGGTGCACCTGGGG - Intergenic
932780558 2:74556101-74556123 CTTCCTGGGTTGGGCAGCTGTGG + Intronic
939355110 2:141091523-141091545 ATTCCAAAGTTGTGCACGTGAGG + Intronic
939792370 2:146593813-146593835 TTTACTGGGTTGTACACTTGGGG - Intergenic
940331976 2:152484972-152484994 TTTTCAAGGTTGTTCACCAGTGG + Intronic
944173894 2:196808208-196808230 ATTCATAGGTAGTGCACCTAGGG + Intronic
944508957 2:200445531-200445553 TTTCCTAGGATGTGATCTTGAGG + Intronic
948893644 2:240918546-240918568 ATGCCTTGGTTCTGCACCTGCGG - Intergenic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1172811968 20:37654600-37654622 TCTACTAGGTAGTGCACCAGTGG + Intergenic
1173228846 20:41178561-41178583 TTTCCTAGATTTTGTATCTGTGG - Exonic
1173430107 20:42980242-42980264 TTTCCAAGGTTTTGCACCAGCGG - Intronic
1175021620 20:55857211-55857233 TTTCCTAGTCTGTGACCCTGAGG + Intergenic
1185337034 22:50275332-50275354 TGCCCTAGGTTGGGCCCCTGGGG - Exonic
951913826 3:27778372-27778394 TTTCTTAGGCTGTGCTTCTGGGG + Intergenic
954075803 3:48179146-48179168 TTTCCCAGAGTGTGCACTTGGGG - Intronic
954916042 3:54149401-54149423 TTTCCCAGGTGGTCCTCCTGAGG - Intronic
955655777 3:61243349-61243371 TTTCTTAGGTTCTGCTCCTGGGG - Intronic
956477501 3:69638127-69638149 TTTCCTAGGTTTTTCTCCTAGGG + Intergenic
957375109 3:79345584-79345606 TTTCCTATTTTGTGTGCCTGAGG - Intronic
958120336 3:89278641-89278663 ATTCCTAATTTGTGTACCTGTGG - Intronic
960148338 3:114226909-114226931 TTTTCTAGGTGGTGAATCTGTGG - Intergenic
960312463 3:116133173-116133195 TTTCCTAGGTTGTGCACCTGAGG - Intronic
963539148 3:146564357-146564379 ATTCCTGGGTTTTGCAACTGTGG - Intergenic
965302902 3:167025512-167025534 TATCCTAGGTCCTGCACCTATGG + Intergenic
968273145 3:197420271-197420293 TTTCCTATTTTGTGCAGCTGGGG - Intergenic
968366909 3:198192592-198192614 CTTCCTAGGTAGTGGATCTGAGG - Intergenic
968705436 4:2075369-2075391 TTTCCTGGGCTGTGCCCATGGGG + Intronic
969479382 4:7439882-7439904 TTCTGTAGGGTGTGCACCTGTGG + Intronic
970416268 4:15860552-15860574 TTTCTTAGCTTGTGCATATGTGG - Intergenic
972827048 4:42770986-42771008 TTTTCTAGTTTGTGCACATATGG - Intergenic
976575410 4:86664468-86664490 TTTAAAAGGTTGTGGACCTGTGG + Intronic
976666415 4:87598221-87598243 TTTTCTAGTTTGTGCACATAAGG + Intergenic
979205026 4:118029050-118029072 TTTCCTAGGTGATGCAAATGGGG - Intergenic
979255319 4:118602201-118602223 CTTCCTAGGTAGTGGATCTGAGG - Intergenic
979263879 4:118679273-118679295 TTTCTTAGGTAGAGCACATGTGG + Intergenic
979333017 4:119438311-119438333 CTTCCTAGGTAGTGGATCTGAGG + Intergenic
980047009 4:128000219-128000241 TTTCCTAGGTTTTTCTTCTGGGG + Intronic
983579227 4:169291329-169291351 TTGCCTATGTTATTCACCTGGGG + Intergenic
986092435 5:4523486-4523508 TTTCCTAGGTCAGGCACCAGAGG + Intergenic
987127407 5:14827339-14827361 TTACCTTGGCTGTGCACCTGAGG - Intronic
989314550 5:40062538-40062560 ATTCCTATGTTCTGCATCTGTGG - Intergenic
994443119 5:99835982-99836004 TTTACTAGGTAGTGCTCCAGTGG - Intergenic
994832474 5:104803332-104803354 TTTTCTAGTTTGTGCACATGGGG - Intergenic
996885064 5:128344468-128344490 TTTCCTGGGATGTGCACTTATGG - Exonic
997439875 5:133901602-133901624 TTTCTCAGGCTGTGCACCTAAGG + Intergenic
999274540 5:150320659-150320681 TTTCCAAGGTAGTGGACTTGGGG - Intronic
1000960210 5:167592092-167592114 TTACCTAGGTTGGGCACCAAAGG + Intronic
1002726133 5:181297790-181297812 CTTCCTAGGTAGTGGATCTGAGG - Intergenic
1002893126 6:1354971-1354993 TTTTCTAGTTTGTGCACATAAGG - Intergenic
1007289943 6:40778066-40778088 TTTCCAAGGTTTTCTACCTGGGG + Intergenic
1008437838 6:51497009-51497031 TTTCCTTGTTAGTGCACCTGGGG + Intergenic
1010580307 6:77588503-77588525 TTCCCTAAGTTGTCCACCTGAGG - Intergenic
1013465499 6:110414097-110414119 TTCCCTAGGTTGTGCCCATAGGG - Intronic
1014219844 6:118788861-118788883 TTTCATAGCTGGTGCACATGTGG - Intergenic
1017862607 6:158413057-158413079 TTTTCTAGGTTGTGCTGGTGAGG + Exonic
1018111974 6:160544984-160545006 TTTCCTAGGATGGCCATCTGAGG + Intronic
1018555552 6:165046603-165046625 TTTCCCAGTGTGTGCACATGAGG - Intergenic
1019069169 6:169327578-169327600 TTTTCTAGGTTGTCAACCTCAGG + Intergenic
1021440568 7:20669597-20669619 TTTCCTAGGCAGAGGACCTGCGG - Intronic
1022303402 7:29122858-29122880 TTTCTTAAGTTTTACACCTGAGG + Intronic
1026040795 7:66866133-66866155 TTTCCTAGGTGGTGGATCTGAGG - Intergenic
1027246709 7:76372551-76372573 TTTCCTAGGTTCTGGGGCTGTGG + Intergenic
1030637795 7:111969760-111969782 TTCCATAGGTTGTGCAGCTACGG - Intronic
1031807437 7:126325608-126325630 TTTCCCAAGCTGTCCACCTGCGG - Intergenic
1031808678 7:126338853-126338875 TTTCCTAGGCTGAGAACCAGAGG - Intergenic
1032884314 7:136121602-136121624 TTTCCTAGATTGAGAACCTCTGG + Intergenic
1033769138 7:144528825-144528847 TCTACTAGCTTGTGCACTTGTGG + Intronic
1035730870 8:1852952-1852974 TTTCCTGGGAAGTGCAGCTGTGG + Intronic
1038432260 8:27509912-27509934 TTTCCTAGGTCATACACCAGGGG - Intronic
1039233910 8:35480459-35480481 TTTCCTTGGTGGAGCTCCTGAGG + Intronic
1041867293 8:62590634-62590656 TTTTCTAAGTAATGCACCTGTGG + Intronic
1043185438 8:77142464-77142486 TTTCCTAGGTTGGGGGCCTGAGG - Intergenic
1046333253 8:112749693-112749715 TTTCCTAGCTTCAGCAACTGAGG - Intronic
1046698319 8:117369806-117369828 TTCACAAGGTTGTGCAACTGTGG + Intergenic
1047595154 8:126370739-126370761 TCTCTTGGGTTGTACACCTGTGG - Intergenic
1049450108 8:142656338-142656360 TAACCTAGGCTGTGCTCCTGAGG - Intergenic
1052878891 9:33588042-33588064 TCTACTAGGAAGTGCACCTGTGG + Intergenic
1055889499 9:81107742-81107764 TCTCTTAGGTTCAGCACCTGGGG + Intergenic
1056628679 9:88274902-88274924 TTTCCTAGGATTTTCAGCTGGGG + Intergenic
1056786990 9:89600302-89600324 TTTCCTAGGTTGGGAAACTAAGG + Intergenic
1060000688 9:119955890-119955912 TCTCTTTGGTTGTGCAGCTGTGG - Intergenic
1062013332 9:134278422-134278444 TTTCCTTGCTTGTGGGCCTGTGG - Intergenic
1062751266 9:138255436-138255458 CTTCCTAGGTAGTGGATCTGAGG - Intergenic
1189553394 X:42116026-42116048 TTTCTTAAATTTTGCACCTGAGG - Intergenic
1196749835 X:119106084-119106106 TTACAAAGGTTGTGCTCCTGGGG + Intronic
1198692188 X:139296442-139296464 TATCCTATATTGTGCACATGTGG + Intergenic
1201766714 Y:17579621-17579643 TGTCCGAGGGTGTGCCCCTGCGG - Intergenic