ID: 960313816

View in Genome Browser
Species Human (GRCh38)
Location 3:116151238-116151260
Sequence AATGATGCACAGAGTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960313816 Original CRISPR AATGATGCACAGAGTGCCCT GGG Intronic
900753789 1:4418925-4418947 ATTCAAGCACAGAGAGCCCTTGG + Intergenic
901938893 1:12646825-12646847 CATGATGGGCAGTGTGCCCTGGG - Intronic
907581754 1:55578471-55578493 AATGAAACAAAGAATGCCCTAGG - Intergenic
908400907 1:63772267-63772289 AATGATAGACAGAGAGGCCTTGG - Intergenic
912573595 1:110643483-110643505 AATTGTGCACAGAGTTTCCTGGG + Intergenic
913963233 1:143354730-143354752 AAAGATGCACAGAGAGACCAAGG - Intergenic
914057589 1:144180316-144180338 AAAGATGCACAGAGAGACCAAGG - Intergenic
914121557 1:144786050-144786072 AAAGATGCACAGAGAGACCAAGG + Intergenic
918403960 1:184193164-184193186 ATTGATCCAGAGAGTGACCTGGG + Intergenic
919116713 1:193288761-193288783 AATGGTGCAGAGAGTTCTCTGGG - Intergenic
921566072 1:216722203-216722225 AATTCTGAAAAGAGTGCCCTTGG - Intronic
922210216 1:223480669-223480691 CCTGCTGCACAGAGCGCCCTTGG + Intergenic
1064965783 10:21013892-21013914 AATGAAGAGCAGAGTCCCCTAGG + Intronic
1065533811 10:26698603-26698625 AATGATTCTCAGTGTGCCATGGG + Intronic
1069861305 10:71473356-71473378 ACAGGTGCACAGAGGGCCCTTGG - Intronic
1074208884 10:111309903-111309925 AATGATTTACAGAGAACCCTTGG - Intergenic
1077158338 11:1101473-1101495 CATGCTGCGCAGAGTGCCATGGG - Intergenic
1081158874 11:39729057-39729079 AATGATGCTCAGAGAGGCCAAGG + Intergenic
1081312459 11:41590547-41590569 CATGATGCACAGAGTGGCAGTGG - Intergenic
1082004923 11:47414171-47414193 AAGGATGGATAGAGTGCCCAGGG - Intronic
1082167170 11:48963223-48963245 GAAGATGCAAAGAGTGCCTTGGG + Intergenic
1084616449 11:70239637-70239659 AATGAGGAACAAAGTGCTCTGGG - Intergenic
1089305212 11:117522153-117522175 AATTAGGCACAGAATGCTCTAGG - Intronic
1091157160 11:133384632-133384654 AATGAGGCACAGAAGGCACTGGG - Intronic
1094852412 12:34388199-34388221 AGGGATGCTCAGGGTGCCCTGGG + Intergenic
1094852715 12:34389417-34389439 AAGGATGCCCAGGGTCCCCTCGG - Intergenic
1094854087 12:34395216-34395238 ATGGATGCTCAGGGTGCCCTGGG - Intergenic
1094854354 12:34396335-34396357 AGGGATGCCCAGAGTTCCCTGGG - Intergenic
1094870309 12:34595939-34595961 AAGGATGCCCAGTATGCCCTGGG - Intergenic
1095355933 12:41275176-41275198 AATGAGCCACACAGTTCCCTGGG - Intronic
1100284142 12:93148758-93148780 AATAATGCTCATATTGCCCTAGG - Intergenic
1100461815 12:94807519-94807541 AATAATACACATAATGCCCTTGG - Intergenic
1106022292 13:25926938-25926960 ATTGGTGCCCAGAGAGCCCTGGG + Intronic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1110614655 13:77528186-77528208 AATAATATACAGAGTTCCCTTGG + Intergenic
1113404603 13:110026678-110026700 AATGATGCAGAGAGTGAGGTGGG + Intergenic
1116761616 14:49022130-49022152 ACTGAGGCACAGGATGCCCTGGG - Intergenic
1120752117 14:88207472-88207494 AAAGATAAACAGAGTGACCTTGG - Intronic
1124611532 15:31212992-31213014 AATGATGCACAGCCTATCCTGGG - Intergenic
1128713990 15:69893696-69893718 CATGATGCCCAGAGTCCCCATGG + Intergenic
1129956280 15:79639738-79639760 AATAAAGCTCAGAGGGCCCTGGG + Intergenic
1134776862 16:16860772-16860794 GATAACGCACAGAGTGCTCTTGG + Intergenic
1135098110 16:19581323-19581345 AAAGATGGACAGAGTGCTGTGGG - Intronic
1135956056 16:26957047-26957069 AATGCTGCACAGAGAGGCCAAGG - Intergenic
1138491964 16:57382271-57382293 CAGGAAGCACAGAGGGCCCTGGG + Exonic
1138918922 16:61502971-61502993 AATGATGCACAAAATGCAATAGG + Intergenic
1140133982 16:72188945-72188967 AAGGGAGCGCAGAGTGCCCTGGG + Intergenic
1143368759 17:6425462-6425484 AGTGCTGCAGCGAGTGCCCTGGG + Exonic
1149340663 17:55682892-55682914 AATGAATGACAGAGTACCCTGGG + Intergenic
1152518124 17:80838008-80838030 GCGGATGCACAGGGTGCCCTTGG - Intronic
1152813277 17:82392290-82392312 CCTGTTGCACAGAGTGCCTTAGG - Exonic
1157170965 18:45404735-45404757 ACTGATGAGCAGAGTGTCCTTGG + Intronic
1158189092 18:54805090-54805112 GAGGATGCTCAGAGTGCCCTTGG - Intronic
1158668167 18:59451364-59451386 ATTGCTGCAGAGAGTTCCCTGGG - Intronic
1160014783 18:75132502-75132524 AATGATACACACAGAGCCCAAGG + Intergenic
1162302298 19:9850734-9850756 AACGATGCACAGCCTTCCCTGGG - Intergenic
1164770195 19:30802310-30802332 AAGGATGCACAGTGCTCCCTTGG - Intergenic
1164862397 19:31572520-31572542 AAGTATGCAAAGAGTCCCCTGGG + Intergenic
1202697072 1_KI270712v1_random:132989-133011 AAAGATGCACAGAGAGACCAAGG - Intergenic
926027348 2:9556278-9556300 ATCGAGCCACAGAGTGCCCTGGG + Intergenic
926115500 2:10210484-10210506 AAGAATGCACAGAGGGCGCTGGG + Exonic
927600215 2:24434402-24434424 AAACATACACAGAGGGCCCTGGG - Intergenic
928256392 2:29726649-29726671 AATCATGCAGTGAGTGCCCTGGG + Intronic
931165296 2:59740812-59740834 ACTGATGCAAAGATTGACCTTGG + Intergenic
933948820 2:87310730-87310752 ATTGAGGCACAGAGTGCCCAAGG - Intergenic
934278233 2:91590003-91590025 AAAGATGCACAGAGAGACCAAGG - Intergenic
935678596 2:105617283-105617305 AGTGATTCACAGACTGCTCTGGG - Intergenic
936331378 2:111550866-111550888 ATTGAGGCACAGAGTGCCCAAGG + Intergenic
936446734 2:112601996-112602018 AATGGTCCACACAGTCCCCTGGG + Intergenic
937950227 2:127380280-127380302 AAGTGTGCACAGAGTGCTCTAGG + Intronic
937993915 2:127679256-127679278 AGTGCTGCACACAGTGCCCCTGG + Intronic
940478103 2:154192110-154192132 AATGATGCGCAGTTTGCCCCGGG - Intronic
945503498 2:210608377-210608399 ATTGCTGCAAAGATTGCCCTAGG + Exonic
946142653 2:217704762-217704784 AATGATGCAGAGCATGCCTTGGG - Intronic
1168931754 20:1629991-1630013 AAAGATGTCCACAGTGCCCTAGG - Intronic
1169474264 20:5916821-5916843 AATGATGCAGCGAGTCACCTGGG - Exonic
1174175384 20:48641251-48641273 AATGAAGAACAAAGAGCCCTTGG + Intronic
1178303885 21:31474402-31474424 ACTGAGGCACAGAGTGCCTGGGG - Intronic
1181441666 22:22939197-22939219 CCTGACCCACAGAGTGCCCTTGG - Intergenic
1183316591 22:37140484-37140506 ACTGAAGCACAGAGAGCCTTAGG + Intronic
1184105648 22:42366123-42366145 AATGATGCGCTGTGTGGCCTTGG - Intergenic
1184322559 22:43753578-43753600 AATGAGGCTCAGAGAGCCCAAGG + Intronic
1185117653 22:48946814-48946836 AATGAAGCACTGAGGGGCCTGGG - Intergenic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
950112942 3:10432174-10432196 ACTGAGGCACAGTGTGCCCGAGG - Intronic
950798762 3:15532331-15532353 AATGACCCAAAGAGTGTCCTTGG + Intergenic
952956872 3:38563062-38563084 AATGCTGCACAGTCTGGCCTTGG - Intronic
955853574 3:63248062-63248084 GGTGATGCACAGAGGGGCCTTGG + Intronic
957793084 3:84963366-84963388 AAAGATGGAGAGAATGCCCTGGG + Intronic
960313816 3:116151238-116151260 AATGATGCACAGAGTGCCCTGGG + Intronic
963598889 3:147360339-147360361 AGTGGGGGACAGAGTGCCCTAGG - Intergenic
967156367 3:186696210-186696232 AATGCTGCACAGAGGGGCCATGG - Intergenic
969032517 4:4226329-4226351 AAAGATGCACAGAGAGACCAAGG + Intronic
969156512 4:5215697-5215719 AATAAAGCACAGAGTGGCTTTGG - Intronic
971348299 4:25832220-25832242 GATGATGCACAGTCTTCCCTTGG - Intronic
972265148 4:37452995-37453017 AAGGATGGACATAGTGTCCTTGG - Intergenic
973880553 4:55267465-55267487 AATGCTGGACAGAGTGAACTAGG - Intergenic
977915268 4:102585696-102585718 AATGTTGAAGAGAGAGCCCTTGG + Intronic
979521922 4:121676967-121676989 AATACTGCACAGAGAGCCCTCGG + Intronic
979692884 4:123579236-123579258 AATGAGGCAGAGCGTGTCCTAGG + Intergenic
980208338 4:129751647-129751669 AATGATCCACAGCCTGCCCCTGG - Intergenic
980294556 4:130894471-130894493 AATGACCCTCAGAGTGACCTCGG + Intergenic
980843957 4:138301681-138301703 AATACTCAACAGAGTGCCCTGGG + Intergenic
983642798 4:169958818-169958840 ACTGATCCACTGCGTGCCCTTGG - Intergenic
984359698 4:178712307-178712329 AATGATGCACAAAAATCCCTAGG + Intergenic
986308184 5:6531188-6531210 AAGGATGCACTAAGTGCTCTGGG + Intergenic
987787341 5:22518768-22518790 ACTGATGCAAGGAGTGCCTTTGG + Intronic
989399564 5:40994216-40994238 AATGAACCACAGAGGGCCCTGGG + Intergenic
991009290 5:61866046-61866068 CCTGATGCACAGACTGACCTGGG + Intergenic
1002986844 6:2198050-2198072 AATGATGCACATCGTGCCACAGG + Intronic
1003545289 6:7052854-7052876 AATGATGCAGTGAGTGTTCTAGG + Intergenic
1003727143 6:8777730-8777752 AATGGTGCAGAGAGTTCTCTGGG - Intergenic
1004115653 6:12764863-12764885 AATGATGGTCTGAGTGCTCTTGG + Intronic
1007136137 6:39523791-39523813 ACAGATGTACAGGGTGCCCTGGG - Intronic
1010612239 6:77967670-77967692 AATGAAGGAAAGAATGCCCTGGG - Intergenic
1012710538 6:102597758-102597780 AAAGAGACACAGACTGCCCTGGG + Intergenic
1013036842 6:106393270-106393292 AATGATGCACAGGGGGTCCAGGG + Intergenic
1014680939 6:124429461-124429483 AAGTATGCACAAAGTGCCATGGG - Intronic
1020746477 7:12085501-12085523 AATCATGCAAAGAGTGCTATGGG - Intergenic
1022821193 7:33962582-33962604 AATGTTGCCCAGAGTCCCCTGGG + Intronic
1024284298 7:47744105-47744127 TCTGATGCAGAGAGAGCCCTAGG - Intronic
1029149114 7:98467648-98467670 AGTGATGCCCATGGTGCCCTTGG - Intergenic
1030119536 7:106094865-106094887 AATGATGCACAAAGTAACCTAGG + Intronic
1032120019 7:129148877-129148899 AATGGTGCTGAGAGTGGCCTGGG - Intronic
1032431393 7:131864802-131864824 AGTGATGAGCAGAGCGCCCTGGG + Intergenic
1033936891 7:146596870-146596892 AATAATGCAAAGAAAGCCCTTGG + Intronic
1034602505 7:152274644-152274666 AATGATGCTCAAAGTGGACTTGG - Intronic
1037359181 8:18054728-18054750 TAAGAGGGACAGAGTGCCCTAGG + Intergenic
1037807913 8:22068764-22068786 AAGGAAGAAAAGAGTGCCCTTGG + Intronic
1038448399 8:27620606-27620628 AAGGAAGCAGAGAGTGCCTTGGG - Intergenic
1038846791 8:31237531-31237553 AAAGATGGACAAAGGGCCCTAGG - Intergenic
1040582218 8:48707452-48707474 AGTGAGGCACCGAGTGCTCTAGG + Intergenic
1045944161 8:107776489-107776511 ATTCATGGACAGAGTGACCTTGG + Intergenic
1046877096 8:119267391-119267413 AATTATACACAGAGTGCTATAGG + Intergenic
1048541396 8:135345218-135345240 AATGCTGCACATAGGGGCCTTGG - Intergenic
1058669594 9:107349313-107349335 ACTGAGGCACAGAGAGCCCCAGG - Intergenic
1060198642 9:121639222-121639244 AAGTATGCACTGAGTGGCCTTGG + Intronic
1060562528 9:124558144-124558166 GATGCTGCACAGAATGCCATAGG - Intronic
1062059042 9:134484794-134484816 ACTGATGCCCAGAGTGACTTTGG + Intergenic
1186581198 X:10820786-10820808 AATGATGCTCAGAGTGGTCGGGG - Intronic
1194150386 X:90318204-90318226 AAACATGCACTGGGTGCCCTAGG - Intergenic
1195402606 X:104477586-104477608 GTTGATGCTCAGAGTGACCTTGG + Intergenic
1199641632 X:149868011-149868033 ACTGCTGCACAAAGTGCTCTGGG - Intergenic
1199972065 X:152868564-152868586 AATGAAGCATAGATTGCACTTGG - Intronic