ID: 960316629

View in Genome Browser
Species Human (GRCh38)
Location 3:116186407-116186429
Sequence GGTACATTTTTAGTTTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 220}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960316629 Original CRISPR GGTACATTTTTAGTTTCTGC TGG Intronic
901329817 1:8397643-8397665 GCTACAGTTTTATTTCCTGCTGG + Intronic
904915694 1:33968765-33968787 TGTACATTCTCAGTTTCTGTGGG - Intronic
908866831 1:68557185-68557207 GGTACATGTGCAGTTTATGCAGG - Intergenic
910754528 1:90673407-90673429 GGCACTTTTTTAGGTTCTGAGGG - Intergenic
910859125 1:91726257-91726279 GGTACATTTTAATTCCCTGCTGG - Intronic
912784103 1:112582317-112582339 ACTAAATTTTTAGTTTCTGGAGG + Intronic
912859845 1:113204039-113204061 GCTAAATTTTTAGTTTTTTCAGG + Intergenic
913085178 1:115430193-115430215 GGTGAAATTTGAGTTTCTGCAGG - Intergenic
913390206 1:118302207-118302229 GGTTAATTTTTAGATTTTGCTGG + Intergenic
914807252 1:151000676-151000698 GGTTAATTTTTAATTTCTGCAGG - Intronic
915919786 1:159966508-159966530 GTTACATTTTTAGTTTTTTGAGG + Intergenic
916160308 1:161905262-161905284 GGTAACTTTTGAGATTCTGCTGG + Intronic
916756996 1:167780759-167780781 GGTACAGTTTCAGTTTTTGCAGG + Intronic
919170247 1:193944831-193944853 GTTCCATTTTTAGTTTTTTCAGG - Intergenic
919247142 1:195003239-195003261 AGTGCATTTTTACTTTCTGAGGG - Intergenic
919680922 1:200433995-200434017 GGTACATTTTGTGTTTCTTTGGG - Intergenic
920748100 1:208647958-208647980 GATATATTTTTAGTTTGTGGTGG + Intergenic
922979217 1:229811329-229811351 GTTCCATTTTTTATTTCTGCTGG - Intergenic
923529829 1:234804328-234804350 AGTCCAATTTCAGTTTCTGCAGG - Intergenic
924046586 1:240038150-240038172 GGTCCTTTTTTAGCTTCAGCTGG - Intronic
924649072 1:245906588-245906610 GTTATATTTTTAGTTTCTTGAGG - Intronic
1063857984 10:10276327-10276349 GTTATATTTTTAGTTTCTTAAGG + Intergenic
1063975951 10:11415662-11415684 GGGACATCTGTAGTTTCTTCCGG - Intergenic
1065676046 10:28175417-28175439 GGTACATTTTGGGGTTCTGCAGG + Intronic
1068554573 10:58444751-58444773 GGTAAATATTTAGTTTCTCTGGG - Intergenic
1068867009 10:61904334-61904356 GGTACAGTTTTAATTTTTGTTGG + Intronic
1071108857 10:82130586-82130608 GTTCCATTTTTAGTTTCTTGAGG + Intronic
1073923354 10:108484046-108484068 GGAACATTTTTACCTTCTGGTGG - Intergenic
1074683919 10:115940238-115940260 GGTACATATTTGGTTTCCTCTGG + Intronic
1075216099 10:120537136-120537158 GTTACATTTTTAATTTCTTTAGG - Intronic
1078797797 11:14610610-14610632 GTTACATTTTTTTTCTCTGCAGG + Intronic
1081265120 11:41011616-41011638 GGTACATTTCTAGTGTCTCAGGG + Intronic
1087242995 11:95801058-95801080 GGAACATTTTTTGTTTCAGTTGG + Intronic
1088406185 11:109481368-109481390 TGTTCTTTTTTAGTTTCTGTTGG - Intergenic
1091661242 12:2385426-2385448 GGAACAATTTTAGTTGCTGGTGG - Intronic
1093263114 12:16965567-16965589 AATACAATTTTAGTTTCTACTGG - Intergenic
1093304414 12:17495669-17495691 TGTACATTTTTGGTTTCTGTTGG + Intergenic
1093330869 12:17836833-17836855 GCTCCATTTTTAGTTTTTTCAGG + Intergenic
1094564616 12:31589066-31589088 GGTACAGTTTTAGCTTCAGTAGG + Intronic
1094626239 12:32126779-32126801 TTTACAATTTTAATTTCTGCAGG - Intronic
1095137708 12:38626135-38626157 TATACATTTTTAGATTCTGCAGG + Intergenic
1095239396 12:39838992-39839014 GGTCCAATTTCATTTTCTGCAGG + Intronic
1098634588 12:72766362-72766384 TGTACAATTATAGTTTCTCCAGG + Intergenic
1099027184 12:77479516-77479538 GGTACAGTTTTAGCTTTTGATGG + Intergenic
1099072478 12:78063387-78063409 GGTACATTTTTGGGGACTGCAGG + Intronic
1099214172 12:79834060-79834082 GGTACATTGTTAGATGCTACAGG + Intronic
1099399293 12:82182165-82182187 CTGACATTTTTAGTTTCTGTTGG - Intergenic
1099548829 12:84017819-84017841 ATTACATTTTTATTTTTTGCTGG + Intergenic
1101479957 12:105086882-105086904 GGTAAATTTTTTTTTCCTGCTGG - Intergenic
1103640925 12:122351620-122351642 GCTACAATTTTAGAGTCTGCTGG - Intronic
1106344930 13:28867167-28867189 GCAACATTTTTAGCTTCTGAAGG + Intronic
1106784767 13:33095671-33095693 GGTATATTTTTAGTTTTTTGAGG - Intergenic
1106928454 13:34637485-34637507 GGTACATTTTTGGCTTTTTCTGG + Intergenic
1109295586 13:60526499-60526521 TGGTCACTTTTAGTTTCTGCTGG - Intronic
1109620564 13:64899997-64900019 GCTACATTTGTGGTTTCTCCTGG + Intergenic
1110102103 13:71619967-71619989 GGCACATGTTTAGTTTCTTCTGG - Intronic
1111028734 13:82568824-82568846 GGTAAATTTTTATTTTCTTGAGG + Intergenic
1112930890 13:104736266-104736288 GGTACATATTTAGTCACTGATGG + Intergenic
1114361708 14:21981136-21981158 GGTACATTTTTAATTCCAGGGGG + Intergenic
1115916745 14:38323130-38323152 GTTATATTTTTAATTTCTTCAGG + Intergenic
1115918877 14:38349406-38349428 GCTACATTTTTAGTTTCTTGAGG - Intergenic
1116072318 14:40063760-40063782 GCTACATTTTTTGTTTTTTCTGG + Intergenic
1116121513 14:40726440-40726462 GCTCCATTTTTAGTTTTTTCAGG + Intergenic
1119499372 14:75110653-75110675 TGTACATATTTAGTATCTGATGG + Intronic
1121212578 14:92219845-92219867 TTTTCATTTTTAATTTCTGCGGG - Intergenic
1121261471 14:92569380-92569402 GTTTCATTTTTTGTTTCTGCTGG + Intronic
1123885550 15:24724032-24724054 GTTCCATTTTTAGTTTTTGGAGG + Intergenic
1124024489 15:25952595-25952617 GTTCCATTTTTAGTTTTTTCAGG + Intergenic
1125736143 15:41927247-41927269 GTTCCATTTTTAGTTTTTGGAGG - Intronic
1126665861 15:51076181-51076203 GCCACATTTTTAATATCTGCTGG + Intronic
1128778390 15:70341536-70341558 GGTAGATTTTTAGTTCCTGTGGG + Intergenic
1129577630 15:76768207-76768229 GGCACATTTTTTATTTCTCCTGG - Intronic
1130330660 15:82919710-82919732 GGCACATTTTTTGCCTCTGCAGG - Intronic
1131885972 15:96913131-96913153 GGTGCCATTTTAGTTTCTGCAGG - Intergenic
1131981153 15:97996178-97996200 GGTACTGTTCTAGTTGCTGCAGG + Intergenic
1132166308 15:99594706-99594728 AATACATATTTGGTTTCTGCTGG - Intronic
1132382731 15:101377900-101377922 TGCACGTCTTTAGTTTCTGCTGG - Intronic
1132869485 16:2109433-2109455 GGTCCATTTTCAGATCCTGCTGG - Exonic
1136631969 16:31494059-31494081 GGTAAATTTTTAGTTTTTGGTGG + Intronic
1138360911 16:56425982-56426004 GTTCATTTTTTAGTTTCTGCTGG - Intergenic
1139930301 16:70520959-70520981 CATACATTTTTATTTTTTGCGGG + Intronic
1140260277 16:73372110-73372132 GGGACTTTTTCATTTTCTGCAGG + Intergenic
1141584741 16:85026314-85026336 GGTACGCTTTTGGTCTCTGCAGG - Intergenic
1143637497 17:8174519-8174541 GGTACATTTTTGTCTTCTGCAGG - Exonic
1147230053 17:39011026-39011048 GGTACATTTTTAAATTTTGTGGG + Intergenic
1147520499 17:41167840-41167862 GCTGCATTTCTAGTTGCTGCAGG - Exonic
1147858321 17:43500177-43500199 GGTAAATTTTTAGTGTGTGCCGG - Intronic
1149171775 17:53820778-53820800 GTTAACTTTTTAGTTCCTGCAGG + Intergenic
1150230864 17:63549797-63549819 GGGACATTTCTAGATCCTGCAGG + Intergenic
1151773544 17:76181448-76181470 TGTACATTTGTATCTTCTGCAGG - Intronic
1152440020 17:80301732-80301754 GTTCTATTTTTAGTTTCTTCAGG - Intronic
1152834035 17:82517915-82517937 GGTACCAATTTAGTCTCTGCTGG - Intergenic
1152911379 17:83006878-83006900 GTTACATGTTTAGTTTTTACAGG + Intronic
1153754963 18:8273168-8273190 AGTACATTTTTAGTTTATTGTGG + Intronic
1155340031 18:24804395-24804417 TGGACATATTAAGTTTCTGCAGG + Intergenic
1155720873 18:29010244-29010266 GGTACATTTTTTTTTTCTGTTGG - Intergenic
1156735557 18:40254214-40254236 GATACTTTTTTAATTCCTGCTGG - Intergenic
1157112872 18:44837505-44837527 CATATATTCTTAGTTTCTGCGGG - Intronic
1157359796 18:46966326-46966348 GGTAGATTTATATTTTGTGCGGG + Intronic
1157360395 18:47019926-47019948 GGTAGATTTATATTTTGTGCGGG + Intronic
1157361384 18:47025841-47025863 GGTAGATTTATATTTTGTGCGGG + Intronic
1159955217 18:74514143-74514165 GGTACATATGTAAGTTCTGCAGG + Intronic
1160391530 18:78537878-78537900 GGTCCATTTTTAGTTTCAAAAGG - Intergenic
1160427126 18:78786233-78786255 GGCTCATTTTTAGTTTCTCCAGG - Intergenic
1165631729 19:37306965-37306987 GCTGCACTTTTAGTTTCTGAAGG + Intergenic
927347725 2:22066091-22066113 GCAACATTTTTAGTCTCTCCAGG - Intergenic
928922839 2:36543046-36543068 GGAACAATTATAGTTTCTACAGG - Intronic
929354854 2:41009554-41009576 GCTATATTTTTAGTTTTTGGGGG + Intergenic
930294928 2:49543364-49543386 GTTACAGTCTTCGTTTCTGCAGG + Intergenic
930949957 2:57128494-57128516 GGTACATTTTTAGTTCATTTAGG + Intergenic
931028306 2:58139536-58139558 TGTTCATTTTTAGTTTCTTCAGG + Intronic
932224303 2:70027344-70027366 GATATATTTTTAGTTTCTTGAGG - Intergenic
933375296 2:81472257-81472279 AGTAAATTTTGAGTTTCTGTAGG + Intergenic
935475256 2:103512776-103512798 GGTTCTTTTTTATTTTCTGTGGG + Intergenic
940064689 2:149614214-149614236 TGTCCATTTTTAACTTCTGCTGG + Intergenic
940395244 2:153182469-153182491 GGTACATTTGTAGGATGTGCAGG + Intergenic
940621268 2:156116980-156117002 TGTCCATTTTTACTTTCTGATGG + Intergenic
941755897 2:169185377-169185399 GATACATTTAATGTTTCTGCAGG - Intronic
942941578 2:181624835-181624857 GGTACATATTTAGAGGCTGCAGG + Intronic
943150969 2:184112452-184112474 GGTACATTTTTAAAATCTGTGGG + Intergenic
943811877 2:192196552-192196574 GGTACAATTTGTTTTTCTGCTGG - Intergenic
943870679 2:192993134-192993156 AGTACATTTTTATTTTCTGAAGG - Intergenic
1172927040 20:38547230-38547252 AGTACATTTTTTTTTTCTGATGG + Intronic
1173382087 20:42554716-42554738 GGTACATTTTTAGTTTCAATTGG + Intronic
1174847163 20:53953715-53953737 AGTACATTTTTAGTGGCTGCAGG + Intronic
1178364921 21:31981933-31981955 GGTACATGTTTAGGATGTGCAGG + Intronic
1180887228 22:19255183-19255205 TGTAGATTTGTAGATTCTGCAGG - Intronic
950537925 3:13591950-13591972 GTTACATTGTTAGCTTCTCCAGG + Intronic
951105421 3:18736528-18736550 GGAAAAGTTTTATTTTCTGCTGG - Intergenic
952596404 3:35023793-35023815 GACACATTTTTAGTATCTGCTGG + Intergenic
954731714 3:52668569-52668591 CTTCCATTTTTAGTTTCTGTTGG + Exonic
955093837 3:55777278-55777300 GGTACACTTCTGCTTTCTGCAGG - Intronic
955422911 3:58757682-58757704 GGTCCATTTTTAGTTTATTCTGG + Intronic
959806147 3:110556342-110556364 GTTCTATTTTTAGTTTTTGCAGG + Intergenic
959987261 3:112588281-112588303 GGTACATTTTTAATTTTTTGAGG + Intergenic
960316629 3:116186407-116186429 GGTACATTTTTAGTTTCTGCTGG + Intronic
960518978 3:118633309-118633331 GATACAGTTGTATTTTCTGCTGG + Intergenic
962538953 3:136358736-136358758 GGCTCATTTTTATTTTTTGCAGG + Intronic
962668629 3:137682174-137682196 GGTTTATTTTTAATTTCTGTGGG - Intergenic
962871385 3:139496265-139496287 GGTAGATTGGTAGTTTCTGTAGG + Intergenic
965792624 3:172405931-172405953 CATACATTTTTTTTTTCTGCAGG + Intergenic
966138121 3:176724135-176724157 GTTCTATTTTTAGTTTCTGGAGG + Intergenic
967708157 3:192676593-192676615 GTTACATTTTGAGTTACTGTAGG - Intronic
967715315 3:192755915-192755937 GCTCTATTTTTAGTTTTTGCAGG - Intronic
967949515 3:194830026-194830048 GCTACATTGCTGGTTTCTGCTGG - Intergenic
968219117 3:196921280-196921302 GTGACATTTTTACTTTCTGATGG - Intronic
969366335 4:6696611-6696633 GTTTCATTTTGAGTTTTTGCCGG - Intronic
970484215 4:16508046-16508068 GCTACATGTTTAGTGGCTGCTGG + Intronic
970697161 4:18691684-18691706 GATACATTTCTAGGTCCTGCTGG + Intergenic
971258883 4:25038426-25038448 GGTACATTTTAAGCTTCTTGAGG - Intergenic
971442403 4:26701753-26701775 GGTAGATATTTAGTTTATGTGGG - Intronic
973195071 4:47430239-47430261 GCTACAGTTTCCGTTTCTGCTGG - Intergenic
974689903 4:65284454-65284476 GTTACAGGTTTATTTTCTGCTGG - Intergenic
974769775 4:66396897-66396919 GCTATATTTTTAGTTTCTTGAGG + Intergenic
975246947 4:72130711-72130733 GGTACAGGATTAGTTACTGCTGG - Intronic
975917710 4:79344507-79344529 GCTCCATTTTTAGTTTTTGGAGG + Intergenic
976677252 4:87716910-87716932 GGTACATTTTTACTCTGGGCAGG - Intergenic
977009828 4:91623319-91623341 GATGCATTTATAGTGTCTGCAGG - Intergenic
978158989 4:105523681-105523703 GGTACATTTTTGGTTGTTGTTGG + Intergenic
979366440 4:119830119-119830141 GGTACCATTCTAGTCTCTGCTGG - Intergenic
980326023 4:131347511-131347533 GCTACATTTTTTGTTTTTGGCGG + Intergenic
980441334 4:132849609-132849631 GTTACATTTTTAGTTTTTTGAGG - Intergenic
980600748 4:135021154-135021176 AGTCTATTTTTGGTTTCTGCTGG - Intergenic
981163794 4:141532165-141532187 GGTACCTTTGTTGTTTATGCTGG - Intergenic
983595013 4:169456655-169456677 GCTATATTTTTAGTTTCTGGAGG - Intronic
983636705 4:169905238-169905260 GGCACCTCTTTATTTTCTGCGGG - Intergenic
983922465 4:173360609-173360631 GGTAAATTTTCATCTTCTGCAGG + Intergenic
984034657 4:174650246-174650268 GGTACATTTTGGATTTCTGTTGG + Intronic
986086248 5:4453228-4453250 GGTCCATTTTTAGTATCTTCAGG - Intergenic
987669618 5:20990239-20990261 GCTACAGTTGTAGTTTCTCCTGG + Intergenic
988148533 5:27344969-27344991 GGCATATTTTTTTTTTCTGCCGG - Intergenic
988557935 5:32254407-32254429 GGAAACTTTTTATTTTCTGCTGG - Intronic
990932334 5:61107129-61107151 GTTCCATTTTTAGTTTTTTCAGG + Intronic
991452216 5:66764327-66764349 GGCACATTTCAAGGTTCTGCTGG + Intronic
993355370 5:86900058-86900080 GGTACATTCCTGGTTTATGCTGG + Intergenic
994863884 5:105238016-105238038 GGAACATTTTGATTTTCTTCAGG + Intergenic
998771860 5:145554813-145554835 GTTACATTTCCAGTTTCTGAAGG + Intronic
1001300412 5:170529502-170529524 GTAACATATTTTGTTTCTGCTGG - Intronic
1005417837 6:25620546-25620568 GTTACATTTTTAGTTTGGACTGG + Intergenic
1005823628 6:29618572-29618594 GGTAGCTTTTTAGTTTGTACTGG + Intronic
1008286679 6:49661276-49661298 GTTACATTTTAATTTTATGCAGG - Intergenic
1011948087 6:92932620-92932642 GGTACATATTTAGCTTTAGCAGG - Intergenic
1012256461 6:97038606-97038628 GCTACATTTTTAGTTTCTTGAGG - Intronic
1012323490 6:97883304-97883326 GGAACATTTTTATTTTTTGGTGG + Intergenic
1012676195 6:102115729-102115751 GCTACAGTTGTAGTTTCTCCTGG - Intergenic
1013695592 6:112699024-112699046 GGTACTTTTTTTTTTTCTGCTGG - Intergenic
1014249300 6:119099411-119099433 GGAAAATCTTTAGTTTCTTCAGG - Intronic
1014570308 6:122998766-122998788 TGTACATTTTCAGTGTCAGCAGG - Intronic
1015087665 6:129314828-129314850 GGTATAATGTTAGTTCCTGCTGG + Intronic
1016800834 6:148167440-148167462 GGTACTTTATTGCTTTCTGCTGG + Intergenic
1020203524 7:6098390-6098412 GGCTTATTTTCAGTTTCTGCTGG + Intergenic
1024490559 7:49977485-49977507 TGTACATTTGTACTTTATGCAGG - Intronic
1024689460 7:51783283-51783305 GGGACATATTTAGCTTCTGAAGG + Intergenic
1024881217 7:54087627-54087649 GTTCCATTTTTAGTTTCTTGAGG + Intergenic
1026881829 7:73911410-73911432 TGTATATTTTTAATTTCTGTTGG + Intergenic
1030490413 7:110225953-110225975 GGTCCATTTTCAGTCTCTGAAGG + Intergenic
1031541444 7:122999665-122999687 GGTACATTTCTATTTCTTGCTGG - Intergenic
1031885233 7:127239452-127239474 GGCATATTTTTAGATTCTGTGGG + Intronic
1032335886 7:131024035-131024057 GGTATATTTTTACTGTCTCCTGG + Intergenic
1033142786 7:138842380-138842402 GGTAGATTTTTTATTCCTGCTGG - Intronic
1033205442 7:139416856-139416878 GGTACATATTTAATTTCTAGAGG + Intronic
1035694448 8:1584498-1584520 TCTTCATTTTTAGTTTCAGCTGG + Intronic
1036293354 8:7515238-7515260 GGTAGAGTTGTAGTTTCTTCTGG + Intergenic
1036329204 8:7805759-7805781 GGTAGAGTTGTAGTTTCTTCTGG - Intergenic
1036534547 8:9634226-9634248 GGTATAATTTTAATTTCTGGAGG + Intronic
1037416248 8:18653006-18653028 CGTACATCTTGAATTTCTGCAGG - Intronic
1037740795 8:21607802-21607824 GGTACATTTTTGGGTTCAACCGG - Intergenic
1038292469 8:26262276-26262298 GGCTCATTTTTTGTTTTTGCGGG + Intergenic
1038323033 8:26546964-26546986 TGTTGATTTTCAGTTTCTGCAGG - Intronic
1039331643 8:36543689-36543711 GGAACTTTGTTAGTTTCTTCTGG - Intergenic
1041294528 8:56341101-56341123 GGTAATTTTTAAGTTTCTGTTGG + Intergenic
1043784101 8:84375029-84375051 TTTACATTTTTAATTTTTGCAGG + Intronic
1046413648 8:113882071-113882093 GTTATATTTTTAGTTTCTTGAGG - Intergenic
1049581909 8:143416284-143416306 TGAACATTTTTAGTTTAGGCCGG - Intergenic
1050670767 9:7994576-7994598 GCTAAATTTTGAGTTTCTGAAGG + Intergenic
1050949874 9:11575033-11575055 TGTTCCTTTTTAGGTTCTGCTGG - Intergenic
1051799327 9:20914128-20914150 GGTAGCTTATTAGTTACTGCAGG - Intronic
1052566599 9:30160927-30160949 GGTACCTGTGTAGATTCTGCAGG - Intergenic
1055063540 9:72095458-72095480 GATACAATTTTACTTTCTACTGG + Intergenic
1055749381 9:79487865-79487887 GGGACACTTTTTATTTCTGCTGG + Intergenic
1057712486 9:97459152-97459174 GGTAAATGTTTAGGCTCTGCAGG + Intronic
1058031044 9:100197862-100197884 AGTATATTTTTAGTTTCTAAGGG + Intronic
1059029195 9:110671799-110671821 GGTGCAATGTTAGATTCTGCAGG + Intronic
1059316874 9:113433272-113433294 GGTGCAATCTTAGTTCCTGCTGG - Intergenic
1061981614 9:134107775-134107797 AGTACATTTTTAGTTTTTTGAGG - Intergenic
1186252673 X:7685617-7685639 TTTACATTTTTAGTATCTTCAGG - Intergenic
1186867084 X:13731452-13731474 TTTACATTTTTTGTTTCTGAAGG + Intronic
1187080833 X:15985518-15985540 GGTTCATTTTCTGTTTATGCAGG - Intergenic
1187583256 X:20631931-20631953 GCTACAGTCTTAGTTTCTACAGG + Intergenic
1189839789 X:45062832-45062854 TGTTCATTTTTACTTTCTACTGG + Intronic
1189955070 X:46269556-46269578 GGAACATTTTTACTTTGTGAAGG + Intergenic
1192281667 X:69693954-69693976 GGTACATTTGTACTTTCTGATGG - Intronic
1192672169 X:73156858-73156880 GATACTTTTTTAGTTTCTAGTGG - Intergenic
1192700354 X:73463027-73463049 GGTCCATTTTTAGTTTTTTTAGG + Intergenic
1193163209 X:78252769-78252791 GCTAAATTTTTAGTTTCTTGAGG + Intergenic
1193589481 X:83370301-83370323 GGTCTATTTTTACTTTCTTCAGG + Intergenic
1194179236 X:90692459-90692481 GGTCTATTTTTAGTTTCTCTCGG + Intergenic
1195411286 X:104569251-104569273 TGGCCATTTTTAGTTTCTGCGGG + Intronic
1195484160 X:105383655-105383677 GCTCTATTTTTAGTTTTTGCAGG + Intronic
1196240081 X:113333289-113333311 GTTACATTTTCAGTTTTTGGAGG + Intergenic
1197229993 X:123993425-123993447 GGTACATTTTTTTTTTCTTGTGG + Intronic
1197235866 X:124062057-124062079 TATACTTTTTTAGTTGCTGCAGG + Intronic
1197940060 X:131779640-131779662 GGAAGATTTTAAGTTTCTGAAGG - Intergenic
1198332496 X:135634525-135634547 TGTACCTTTTCAGTTTCTCCTGG - Intergenic
1202282408 Y:23203466-23203488 GGTTCATTTTGAGATTCTGTGGG + Intergenic
1202283483 Y:23215053-23215075 GGTTCATTTTGAGATTCTGTGGG - Intergenic
1202434079 Y:24817851-24817873 GGTTCATTTTGAGATTCTGTGGG + Intergenic
1202435160 Y:24829439-24829461 GGTTCATTTTGAGATTCTGTGGG - Intergenic