ID: 960321706

View in Genome Browser
Species Human (GRCh38)
Location 3:116244692-116244714
Sequence GTTTGTTTTCTAATAAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 305}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960321706_960321710 -8 Left 960321706 3:116244692-116244714 CCCCTCCTTATTAGAAAACAAAC 0: 1
1: 0
2: 1
3: 28
4: 305
Right 960321710 3:116244707-116244729 AAACAAACTCCAAAAACATCAGG 0: 1
1: 0
2: 1
3: 45
4: 549
960321706_960321711 -7 Left 960321706 3:116244692-116244714 CCCCTCCTTATTAGAAAACAAAC 0: 1
1: 0
2: 1
3: 28
4: 305
Right 960321711 3:116244708-116244730 AACAAACTCCAAAAACATCAGGG 0: 1
1: 0
2: 1
3: 45
4: 492
960321706_960321713 26 Left 960321706 3:116244692-116244714 CCCCTCCTTATTAGAAAACAAAC 0: 1
1: 0
2: 1
3: 28
4: 305
Right 960321713 3:116244741-116244763 ATTTATTGCTGACACATAGTAGG 0: 1
1: 0
2: 1
3: 38
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960321706 Original CRISPR GTTTGTTTTCTAATAAGGAG GGG (reversed) Intronic
900756255 1:4437120-4437142 ATTGGTTTCCTAATAAGAAGAGG + Intergenic
900852507 1:5155098-5155120 GTTTTTTTTTCAGTAAGGAGAGG - Intergenic
900922125 1:5679568-5679590 GTCTGTTTCCTTATCAGGAGAGG - Intergenic
901187521 1:7384747-7384769 GTGTGGTTGCTAATTAGGAGGGG + Intronic
901895892 1:12311544-12311566 GGTTGTTCTCTAATAAGCCGCGG - Exonic
902156477 1:14491670-14491692 CTTTCCTTTTTAATAAGGAGTGG + Intergenic
902178153 1:14667001-14667023 GTTGGTTCTCTTATAAGAAGAGG - Intronic
905719327 1:40183309-40183331 ATGTGTTTTCTAATAGAGAGGGG - Intronic
905924688 1:41741189-41741211 GTTTGCTTTCAAAAAAGGAGGGG + Intronic
906438068 1:45814205-45814227 CTTTTTTTTTTAATAAGTAGGGG - Intronic
907541041 1:55215478-55215500 GTTTGTTTTAAACGAAGGAGCGG + Intergenic
908654667 1:66375540-66375562 GTTTGTTTTCTACTGAGAAGAGG + Intergenic
908687787 1:66741553-66741575 GTTGGTTTTCTAATTGGGATGGG - Intronic
909816212 1:79997488-79997510 GTTTGCAGTCTAATAAGGAAAGG - Intergenic
909914662 1:81302269-81302291 ATTTGAATTCTAATAAGGACTGG - Intergenic
910052227 1:82988286-82988308 CTTTGTTTTTTAATAAAGTGGGG - Intergenic
911827835 1:102509758-102509780 GTTTGTTTTCACATAAGTATAGG - Intergenic
911904196 1:103546231-103546253 TTTTGTTTTTTAATAAGAAATGG + Exonic
912538074 1:110390814-110390836 GTTGGTTTTCTAACAACGACTGG - Intronic
913530795 1:119732916-119732938 TTTTTTTTTCTCATATGGAGTGG - Intronic
916175751 1:162036868-162036890 TTTTGTATTTTAATAAGGACAGG - Intergenic
916830840 1:168489288-168489310 GTTTGGTTTCTGAGAAGAAGGGG + Intergenic
917586500 1:176432636-176432658 TTTTTTTTTTTAATAAAGAGGGG + Intergenic
918561382 1:185871554-185871576 TTTGGTTTTCTAATAGGCAGAGG + Intronic
918735831 1:188062035-188062057 GTTTGTTTTGGTATAAGGAAGGG + Intergenic
919234819 1:194827420-194827442 GTTTGATTTATTATAAGGAATGG + Intergenic
920008175 1:202848697-202848719 GTTGGATTTCTAATAGGGACCGG + Intergenic
921045524 1:211474500-211474522 ATTTCTTTTCTACTAAGGAGAGG + Intergenic
921334111 1:214069030-214069052 GTTTGTTTTCTGTCAGGGAGAGG + Intergenic
921857806 1:220007166-220007188 GTTTGTTTTCAAATAAACATAGG - Intronic
921906824 1:220504131-220504153 GTTTGTTTTCTAATAAAACTGGG + Intergenic
922333685 1:224600834-224600856 GTATATTTTCTTATAAGGACAGG - Intronic
924673663 1:246153641-246153663 GTTTGTTTTTTAATACAGACAGG + Intronic
924680885 1:246231841-246231863 GTTTATTTTATGTTAAGGAGAGG + Intronic
1063031109 10:2235802-2235824 GATTATTTTCTATCAAGGAGTGG - Intergenic
1063595697 10:7433716-7433738 GTCTGTTTTTTAATATGGCGTGG - Intergenic
1064114039 10:12562511-12562533 GTTTGGATTCTATTAAGCAGGGG - Intronic
1064894410 10:20217843-20217865 ATTTCTTTTCTAGGAAGGAGAGG - Intronic
1065780164 10:29159978-29160000 GTTTGTTTTCGAAATTGGAGAGG + Intergenic
1066471564 10:35702743-35702765 GTTAGTTTTCTGATAAGAATGGG - Intergenic
1067368421 10:45658873-45658895 GCTTTTTTTCTTGTAAGGAGTGG - Intronic
1071558570 10:86626910-86626932 GTTTTTTTTTTAATAATTAGTGG + Intergenic
1073813736 10:107181704-107181726 TTTTTTTTTTTAATAAGCAGAGG + Intergenic
1075154182 10:119960470-119960492 GTTTTTACTCTATTAAGGAGGGG + Intergenic
1075605505 10:123802651-123802673 GTTTGGTGTATAATTAGGAGTGG + Intronic
1078138469 11:8672358-8672380 GCTTGTCTACCAATAAGGAGAGG - Intergenic
1079905749 11:26245111-26245133 CCTTATTTTCTAATAAAGAGGGG - Intergenic
1080281085 11:30557577-30557599 TTTTGTTTTCTTTTAAGGAAAGG + Intronic
1080423896 11:32138694-32138716 GTTTTTTTTCTAATATGGCAAGG + Intergenic
1080625704 11:34028891-34028913 GTTTAATTTTTAAAAAGGAGGGG + Intergenic
1081212774 11:40356539-40356561 CCTTATTGTCTAATAAGGAGTGG - Intronic
1084934561 11:72579936-72579958 ATTTGTTTGCTGACAAGGAGAGG + Intronic
1085615151 11:77992089-77992111 ATTTGTTTTCTAATAAAGAATGG - Intronic
1087507381 11:99043052-99043074 CTTTATTTTCTTATAAGGATAGG - Intronic
1088855308 11:113745084-113745106 TTTTTTTTTTTAATAAGGGGAGG - Intronic
1089904901 11:122028544-122028566 GTTTGTTTTTCAATTAAGAGAGG - Intergenic
1091871691 12:3896704-3896726 TTTTGTTTTCAAAGAATGAGAGG + Intergenic
1093250301 12:16794594-16794616 TTTTGTTTTCTAAAAACCAGAGG + Intergenic
1093678730 12:21975326-21975348 TTTTGTTTCCTAATGAGGACAGG - Intergenic
1094770858 12:33657603-33657625 GTTTTTTTTTAAATAAGGAAAGG - Intergenic
1095819285 12:46459819-46459841 GTGTGTTTTCTATGCAGGAGGGG + Intergenic
1096373425 12:51087245-51087267 TTTTCTTTTCTAATAGAGAGAGG + Intergenic
1097255480 12:57670437-57670459 GTTTGTTTTCTAATAGAGAAAGG - Intergenic
1097633728 12:62096460-62096482 ATTTGTTTTTTAAAAAGCAGAGG + Intronic
1097808953 12:63997690-63997712 GTTTGTTTGCTGTAAAGGAGTGG + Intronic
1098242416 12:68481699-68481721 GAATGGTTTCTAAAAAGGAGAGG - Intergenic
1099624301 12:85049279-85049301 GGTTATTTGCTAATAATGAGGGG - Intronic
1100363279 12:93897377-93897399 ATTTCTTTTCTAACAAAGAGTGG - Intergenic
1104541094 12:129665275-129665297 CTTTGTTTTCTAATTAGCTGAGG - Intronic
1106206146 13:27597085-27597107 TTTTGATTTCTGATAAGGATAGG - Intronic
1106319962 13:28627910-28627932 GTTTGTTTTTTAATAGAGATAGG - Intergenic
1107080402 13:36368436-36368458 ATTTTTTTTTTAATAAGGAGGGG - Intronic
1107173541 13:37373313-37373335 GTTTATTTTCTAAAGAGGAGAGG - Intergenic
1107282424 13:38751804-38751826 TTTTTTTTTCTAACAAGGACTGG + Intronic
1108196064 13:47996451-47996473 GTTTATGTGCTTATAAGGAGAGG - Intronic
1109207695 13:59500426-59500448 GTTTGCATGCTAATAAGAAGGGG + Intergenic
1109660935 13:65459138-65459160 CTTTCTTTTCTAACAAAGAGCGG - Intergenic
1109744789 13:66610765-66610787 ATTTTTTTCCTAATAAAGAGAGG + Intronic
1110100528 13:71595771-71595793 GTTTGTGCTCTCCTAAGGAGTGG - Intronic
1110151085 13:72254187-72254209 TTTTGTTTTCTAAAAATGGGTGG + Intergenic
1110465385 13:75794370-75794392 GTTTGTTTTCTGGAAAGGAATGG + Intronic
1110714470 13:78685348-78685370 GTTACTTTACCAATAAGGAGTGG + Intergenic
1112405047 13:99111953-99111975 GTTTGTTTTGACATAAGGATTGG + Intergenic
1112466086 13:99646282-99646304 TTTTAATTTCTAATGAGGAGTGG + Intronic
1113282235 13:108801155-108801177 GTTTATTTTCTAGTAAGAGGTGG - Intronic
1113347290 13:109492142-109492164 GTTTGTTTTCTGATAAATACAGG + Intergenic
1114196867 14:20485875-20485897 ATTTCTTTTCTAACAAAGAGTGG + Intergenic
1114853442 14:26408468-26408490 GTTTGTTTGCTAAGCAGCAGTGG + Intergenic
1116256661 14:42565480-42565502 CTTTTTTTTTTAATAATGAGTGG + Intergenic
1116308799 14:43294046-43294068 GTTTGTTTTGTAATACTGACAGG + Intergenic
1116410848 14:44621705-44621727 ATTTGTTTTCTAATTATGAAAGG + Intergenic
1116440783 14:44950282-44950304 GTTTCTTATCTAATAGTGAGAGG - Intronic
1117740318 14:58811937-58811959 GTATGTTTTCTAGGAAGAAGGGG + Intergenic
1118923989 14:70174761-70174783 GTTTATTTTCTGATGAGGGGTGG + Intronic
1119416859 14:74476732-74476754 GTTTGGTTCCTAAAAAGGGGTGG - Intronic
1121814036 14:96915453-96915475 GCTGGTGTCCTAATAAGGAGTGG - Intronic
1121898531 14:97671503-97671525 GCTGGTGTTCTCATAAGGAGAGG + Intergenic
1121978753 14:98433172-98433194 GTCTGTTTGATCATAAGGAGTGG + Intergenic
1123684729 15:22788655-22788677 GTTAGTTTTCTAAAAAGTTGAGG + Intronic
1123958560 15:25367871-25367893 GTATGTTTTCTGTTGAGGAGTGG - Intronic
1123966310 15:25462930-25462952 GTTTATTTTGTAATTAGGTGAGG - Intergenic
1125825319 15:42671599-42671621 GTTTTTTTTTAAATAAGGAAAGG + Intronic
1125869877 15:43090164-43090186 GTTTATTTACTAATATGGAAAGG + Intronic
1127546514 15:59998321-59998343 ATTTGTTTCCTATTATGGAGAGG + Intergenic
1127589283 15:60407433-60407455 GATTGCTTTCTAATAGGGTGGGG + Intergenic
1128200521 15:65802562-65802584 GTTTGTTTTTTAATAGAGACAGG - Intronic
1128805259 15:70526229-70526251 GTTTGTCTTCAAATAGGGGGAGG - Intergenic
1129142695 15:73614957-73614979 GTTTGTTTTCTAACAAGCAAGGG + Intronic
1130759192 15:86800080-86800102 GCTTGTTTACTAATAAGTAATGG + Intronic
1135238859 16:20784850-20784872 GTTTGTTTTGTGCTAGGGAGAGG + Intronic
1135981804 16:27153621-27153643 GTTTCCTTTCTACAAAGGAGGGG - Intergenic
1138832616 16:60393494-60393516 GTATGTTTTCTAACATGGAGTGG - Intergenic
1139087416 16:63603963-63603985 GTATGTTTATTAATAAGGAATGG + Intergenic
1140498566 16:75411943-75411965 GTTTTTTTTATAGAAAGGAGAGG - Exonic
1141052071 16:80776991-80777013 GTTTTTTTTTTAATAGGGACGGG + Intronic
1141802124 16:86317249-86317271 TTTTTTTTTCTAATTAGGAAAGG - Intergenic
1143273535 17:5693304-5693326 TTTTGTTTTCTAATATGATGAGG + Intergenic
1143480149 17:7223469-7223491 ATTTGTTTTCTTAAAAGGGGTGG - Intronic
1145407503 17:22617674-22617696 GTTTGTTTTGTAACATGAAGTGG + Intergenic
1146826860 17:36030619-36030641 TTTTTTTTTTTAATAAGGAAAGG - Intergenic
1150172198 17:63010158-63010180 GTTTGTTTTTTATTAATGAGTGG + Intronic
1151008524 17:70465298-70465320 CTTTTTTTTCTAATAAGTAGAGG + Intergenic
1152764979 17:82131567-82131589 GTTTGTTTTTTAATAGAGACAGG - Intronic
1152936581 17:83140896-83140918 TTTTTTTTTCTAATTAGGAATGG - Intergenic
1153100632 18:1465047-1465069 GCTTGTTTTCTAATAAGTGGTGG - Intergenic
1153590116 18:6665017-6665039 GTTTGTTTTCTAATCAGCAAAGG - Intergenic
1153887713 18:9481641-9481663 GTTTATTTTATAATAAAGTGTGG + Intronic
1153978976 18:10293436-10293458 GTTTTTTTTTTAGTAAGGAAAGG + Intergenic
1155005551 18:21725994-21726016 GTTTGTTTTCAAGTGTGGAGTGG + Intronic
1155415790 18:25597927-25597949 GTTTGTTTTCCTAGATGGAGAGG + Intergenic
1156061874 18:33087533-33087555 GTGTGTTTTCTAAGAAACAGGGG + Intronic
1156187215 18:34677150-34677172 GTTCCTTTTCTACTAAGAAGTGG - Intronic
1158415886 18:57249439-57249461 GTGTAATTCCTAATAAGGAGGGG + Intergenic
1163467008 19:17474114-17474136 GTTTATTTTTTATAAAGGAGAGG + Intronic
1165579296 19:36848661-36848683 TTTTGTTTTGTTTTAAGGAGCGG + Intronic
1166086191 19:40476901-40476923 GTTTGTTTTTTGAGGAGGAGGGG + Intronic
1167773832 19:51541929-51541951 GTTTCTTATCTGATAATGAGGGG - Intergenic
1168496865 19:56860370-56860392 GTTTGTTTTCTAAGAAAAAGGGG - Intergenic
1168526710 19:57094372-57094394 TTTTGTTTTTTAAGACGGAGTGG - Intergenic
925342568 2:3147480-3147502 GTTTCTTGTCTAGAAAGGAGAGG - Intergenic
926966781 2:18423622-18423644 GCTGGTTTTCTTATAAGAAGAGG - Intergenic
927711809 2:25330793-25330815 GTTTTCTTTTTAATAAGGGGAGG - Intronic
929195647 2:39181671-39181693 GTTGGTTTCCTTATAAGAAGAGG + Intronic
930228490 2:48819335-48819357 GTTTGTGTGCTAATGAAGAGAGG + Intergenic
930592325 2:53342703-53342725 GTTTATTTTTTAATATGAAGTGG + Intergenic
930609913 2:53530632-53530654 TTTTGTTTTCTAAGGAGGATGGG + Intergenic
931619541 2:64195964-64195986 GGTTGTTTTCTAAACAGGAAAGG + Intergenic
931804970 2:65795604-65795626 GTTTTTTTTTTAACAAGGAAAGG - Intergenic
931966885 2:67544732-67544754 ATTTGTGATCTAATCAGGAGTGG - Intergenic
932608887 2:73183892-73183914 GTTTTGTTTCTAATAAAGACAGG - Intergenic
933263949 2:80160962-80160984 GTTTATTTTTTAATCATGAGTGG + Intronic
935498764 2:103812460-103812482 GTTTATTTTCTGATGAGGGGAGG - Intergenic
935771090 2:106421874-106421896 GTTTGTTTTTTAAAATGTAGTGG - Intronic
935795985 2:106642028-106642050 GTTTGTTTTGTTTTAATGAGGGG + Intergenic
936001899 2:108841028-108841050 GTTTGTTTTTTAGTAGGGATGGG + Intronic
936130772 2:109839190-109839212 GTTTGTTTTTTAAAATGTAGTGG + Intronic
936213925 2:110532295-110532317 GTTTGTTTTTTAAAATGTAGTGG - Intronic
936423062 2:112386855-112386877 GTTTGTTTTTTAAAATGTAGTGG - Intronic
936865719 2:117074324-117074346 GATTTTTTTCTAATCAGGTGTGG - Intergenic
937088009 2:119184603-119184625 GTATGTTTTATAATAAGCAAAGG + Intergenic
938189601 2:129264244-129264266 GATTGTTTTATAGTAAGGAATGG + Intergenic
938957433 2:136311620-136311642 GTTTCTTCTCTCATTAGGAGTGG + Intergenic
939087262 2:137736262-137736284 TTTGGTTTCTTAATAAGGAGGGG + Intergenic
939295708 2:140261945-140261967 GTTTGTTTTTTAATTATGAGAGG + Intronic
939966842 2:148618692-148618714 GTTTTTCTTCTCATGAGGAGAGG - Intergenic
940052893 2:149482764-149482786 TTTTGTGTCCTAAAAAGGAGAGG - Intergenic
940379217 2:152995143-152995165 GTATTTTTTCTTATAAGGACAGG + Intergenic
940574400 2:155481670-155481692 CTTTTTTTTCTAACATGGAGAGG + Intergenic
941725828 2:168859050-168859072 GTTTGTTCTTTGATAAGGTGAGG - Intronic
942956332 2:181778246-181778268 GTTTCTTTTCTAATAAGGGCAGG + Intergenic
943045172 2:182852072-182852094 CTTTTTTTTCCAATAAGGTGTGG + Intronic
943537206 2:189167424-189167446 GTTTGTTTTAAAAAATGGAGTGG - Intronic
944467030 2:200012385-200012407 TTTTATTTTCTGATAAGTAGTGG - Intergenic
945652464 2:212580666-212580688 ATTTGTTTACTAATGAGGATGGG + Intergenic
947285565 2:228510822-228510844 GTTTGTTTTCTAACAAGTCATGG + Intergenic
947610819 2:231524131-231524153 GTTGGTTTTATTATAAGCAGTGG + Exonic
947695323 2:232181821-232181843 GTTTGTTTTTTAGTAATGATGGG + Intronic
1169188084 20:3636439-3636461 TTTTGTTTTCAAATTAGGAATGG - Intronic
1169639871 20:7739783-7739805 TTTTGTTTTTTAATAAAGACTGG - Intergenic
1169939464 20:10920838-10920860 GTTTGTTTCCTAAAAAGCATGGG + Intergenic
1171055402 20:21901791-21901813 GTTTATTTTATAATAGAGAGGGG - Intergenic
1172848066 20:37941814-37941836 TTTTTTTTTCTAAGAAGAAGGGG + Intronic
1172958177 20:38777329-38777351 GTTTGTTTTTTAATAGAGACAGG - Intergenic
1173283762 20:41652293-41652315 TTTTGTTATCTCATAAGCAGAGG + Intergenic
1174475523 20:50793473-50793495 TGTTGTTTTTTAAAAAGGAGGGG - Intergenic
1174640096 20:52036334-52036356 GGTTGCTTTCTGACAAGGAGAGG - Intergenic
1177598007 21:23271142-23271164 GTTTGCTTTTTAAAAGGGAGAGG + Intergenic
1177665959 21:24159896-24159918 GTTTGTTTTTTAATATGAATAGG + Intergenic
1178582756 21:33850200-33850222 CTTTGTTTTCTCCCAAGGAGGGG - Intronic
1182797273 22:33000191-33000213 GTTTGTTTTTAAATGAGGTGGGG - Intronic
1183288179 22:36981056-36981078 GTTAATTTTCTAAGAAAGAGAGG - Intergenic
1184378460 22:44130003-44130025 GTTTGTTTTCTAATTGAGGGAGG + Intronic
1184722170 22:46321188-46321210 GTTTGTTTTCTTGTATGGAGTGG - Intronic
1184771714 22:46600734-46600756 TTTTGATTTCTAATAGCGAGTGG - Intronic
950252623 3:11479599-11479621 GCATGTTTTCTAAAAAGGAAAGG + Intronic
950855969 3:16105490-16105512 GTTTGTATTCTTATAAGAAGAGG + Intergenic
950856145 3:16107241-16107263 GTTGGTATTCTTATAAGAAGAGG - Intergenic
950957988 3:17075317-17075339 GTTTGCTGTCTTATAAGGAAGGG + Intronic
951187487 3:19730606-19730628 GTTTGTTTTCCTATAACGACTGG - Intergenic
951642381 3:24850537-24850559 TTTTGTTGTTTAATAGGGAGTGG + Intergenic
951678034 3:25264223-25264245 GTTTGTAATCTAAGGAGGAGAGG + Intronic
951806033 3:26644709-26644731 GACTATTTTCTAATAAGCAGTGG - Intronic
952829853 3:37555526-37555548 GTTTGATTTTTAAGAAGGAGAGG + Intronic
953427860 3:42810510-42810532 GTCTTTTTTTTAATAAGGAAAGG - Intronic
953755328 3:45641155-45641177 TTTTCTCTTCTAAGAAGGAGGGG - Intronic
954475954 3:50745881-50745903 GTTTGTTTTCTTTTCAGGGGAGG + Intronic
955052270 3:55424197-55424219 GTTTATTTTCTACAAAGGACTGG - Intergenic
957126323 3:76165935-76165957 GTTTGCTGTCTTATAGGGAGTGG + Intronic
957175640 3:76804406-76804428 GTCGGTTTTCTAACAAGGATAGG + Intronic
959077759 3:101768036-101768058 GTTTTTTTCCTAACAAGGAAAGG + Exonic
960148431 3:114227709-114227731 GTTTGTATTCTATCAGGGAGGGG + Intergenic
960321706 3:116244692-116244714 GTTTGTTTTCTAATAAGGAGGGG - Intronic
961958521 3:130829342-130829364 ATTTGTTTTCTAACAAAGAGCGG + Intergenic
963218314 3:142776434-142776456 GTTTGTTTTCTATTTAGGTATGG + Intronic
964093431 3:152902670-152902692 TATTGTTTTTTAATAAGTAGAGG - Intergenic
967897400 3:194409284-194409306 GTTTGTTTTATATTCAGGATTGG - Intronic
968345344 3:197999881-197999903 ATTTGTTTTCGAATAAGCAGGGG + Intronic
969130010 4:4984128-4984150 GTTGGTGTCCTCATAAGGAGGGG + Intergenic
969711123 4:8844601-8844623 GTTTGTTTTTTATTAAAGACAGG - Intergenic
970924334 4:21433429-21433451 GTTTGTTTTTTAATAGAGATGGG - Intronic
971266861 4:25103406-25103428 GTGTGTTTTCTAAAAATGATAGG - Intergenic
972753086 4:42012760-42012782 GTTTGTTTTTTAATGTGGAGGGG - Intronic
973278789 4:48337811-48337833 GTTTCTTTTCTAAGCAGGTGTGG - Intergenic
974395644 4:61331126-61331148 GTCTGTTTTCTAAAGAGAAGTGG + Intronic
974613860 4:64255246-64255268 CATTGTTTTCTTATATGGAGAGG + Intergenic
974850919 4:67404403-67404425 CTTTGTTTTCTACTATTGAGTGG - Intergenic
977592783 4:98844954-98844976 GGTTGTTTTGTAAAAGGGAGGGG - Intergenic
978647854 4:110961510-110961532 AATTGTTTCCTAATAAGGATAGG + Intergenic
978855689 4:113391774-113391796 GTTTTTTTTTTAATAAAGATGGG + Intergenic
980498472 4:133616277-133616299 GTTTCTTTTAAAATAAGCAGTGG + Intergenic
980634999 4:135490897-135490919 TTTTGTTTTCTGATAAGCAAAGG - Intergenic
981553945 4:145971362-145971384 GTTTGTTTTATAATATCCAGAGG - Intergenic
982038223 4:151368243-151368265 GATTGTTTTTTAATAAGGAAAGG - Intergenic
982995462 4:162338349-162338371 GTCTATTTTCAAATAAGGAAAGG + Intergenic
983128337 4:163982618-163982640 GTTTGGTTTTTAACAAGGATTGG + Intronic
983363217 4:166754533-166754555 GTTTAATATCTAATAATGAGTGG - Exonic
983993841 4:174157414-174157436 GTTTATTTTCAAAGAAAGAGTGG - Intergenic
984342919 4:178481895-178481917 GTATTTTTTCTGAAAAGGAGAGG - Intergenic
984569422 4:181373786-181373808 GTTTGTTATATAATAGAGAGAGG + Intergenic
985121761 4:186650322-186650344 GTTTTTTTTCTGTTATGGAGAGG - Intronic
986138965 5:5011645-5011667 CTTTGTTTTCTATTTAGGAGGGG - Intergenic
988904450 5:35771797-35771819 GCTCGTTTTCTACGAAGGAGAGG - Intronic
990605717 5:57407868-57407890 GTTTGTGTTCTTTTAAGAAGAGG + Intergenic
990857998 5:60293126-60293148 TTTTTTTTTCTGATAAGGGGAGG - Intronic
991384817 5:66074268-66074290 GTTTATTCTCTAAAAATGAGAGG + Intronic
991403531 5:66278758-66278780 GTTTGTTTCCTAATTCGTAGAGG + Intergenic
991553997 5:67874837-67874859 GTTAGTTTACTAAGAGGGAGTGG - Intergenic
992161042 5:74002288-74002310 GTTTGTTTTTAAATCAGGAATGG + Intergenic
993859898 5:93123505-93123527 GTTAGTTTTCTATTAAACAGTGG - Intergenic
996341027 5:122439091-122439113 GTTTTTTTTCTAATTAGGTAGGG - Intronic
997132295 5:131289257-131289279 GTATGTTTTCTCATCAGAAGTGG + Intronic
997982361 5:138476425-138476447 GATAGTTTTCTAAAGAGGAGAGG + Intergenic
999050428 5:148518276-148518298 GTTTATATTCTAACAAAGAGAGG - Intronic
1000749774 5:165079802-165079824 GTATGTTTTATAATAATAAGAGG - Intergenic
1000864422 5:166494823-166494845 GTGTGTTTTCTAAGAATTAGAGG + Intergenic
1001204515 5:169749795-169749817 GTTTGCTTTTTAACCAGGAGGGG - Intronic
1001656869 5:173357778-173357800 ATTACTTTTGTAATAAGGAGAGG - Intergenic
1004293257 6:14387475-14387497 GTTTTTTTTTTAATAAGGAAAGG + Intergenic
1006601180 6:35227301-35227323 GTTTGTTTTCAAATAAAAAAAGG + Intronic
1009713500 6:67355824-67355846 GATTGTTTTGTTATAGGGAGAGG + Intergenic
1011611730 6:89158233-89158255 GATTGTTCTCTAATAGGAAGAGG - Intronic
1013157642 6:107508742-107508764 GATTGTTTTGTGATACGGAGGGG + Intronic
1013263060 6:108466057-108466079 GTTTATTTTTTAACAAGGATTGG - Intronic
1013423813 6:109992109-109992131 GTTTGTTTTGTAATGATTAGTGG - Intergenic
1013690386 6:112634801-112634823 GTTTGTTTTTTAATAGGCTGAGG + Intergenic
1014621170 6:123668416-123668438 GTTATTTTTCTTATAAGGTGGGG - Intergenic
1016390959 6:143574533-143574555 TTTTTTTTTCTACTCAGGAGTGG + Intronic
1017217831 6:151931012-151931034 TTTTGTTTTTTTGTAAGGAGTGG + Intronic
1017700006 6:157059863-157059885 TTTTGTTTTAGAACAAGGAGGGG + Intronic
1018293265 6:162315126-162315148 GTTTGTTTTTAAGGAAGGAGAGG - Intronic
1018973146 6:168543011-168543033 GTTGGTATTCTAATGAAGAGGGG + Intronic
1021822676 7:24513801-24513823 GTTTGTTCTCTGAAAAGGAAGGG + Intergenic
1023778134 7:43629936-43629958 GTTTCTTTTTTAATAACTAGAGG + Intronic
1024103898 7:46060973-46060995 GTATGTTTTGAAATAATGAGTGG + Intergenic
1024519913 7:50296558-50296580 ATTTGTTTTCCAATATGCAGAGG - Intergenic
1024770520 7:52716126-52716148 TTTTCTTTTCTAACAAAGAGCGG - Intergenic
1029551741 7:101240301-101240323 GTTTGTTTTTTAATAAGAGACGG + Intronic
1030198815 7:106880967-106880989 GTTGGTTTTCTTATGAGGAAGGG - Intronic
1030445297 7:109641881-109641903 GGTTGTTCTCTAATGGGGAGGGG + Intergenic
1030672425 7:112352156-112352178 GTTTGTTTTTTCATAAGGAAAGG - Intergenic
1031132647 7:117850350-117850372 GTTTGTTTTGTTTTAAGAAGGGG - Intronic
1031206541 7:118765166-118765188 GTTTGTTTTCAAACAATGAAAGG - Intergenic
1031452713 7:121941590-121941612 ATTTGTTTTATAATCAGGTGTGG + Intronic
1032743995 7:134767578-134767600 GTGTGTTTTCTGGTTAGGAGGGG + Intronic
1034025121 7:147694045-147694067 CTTTGTTTTTTAATCATGAGTGG + Intronic
1034482168 7:151330586-151330608 TTTTCTTTTCTAACAAAGAGCGG + Intergenic
1039220317 8:35323298-35323320 ATGTGTTCTCTAAAAAGGAGTGG + Intronic
1040011179 8:42662312-42662334 CTTTGTGTTCTTATAAGAAGAGG - Intergenic
1040572260 8:48621639-48621661 GATTGTTTTCTAAGAAAGAAAGG - Intergenic
1040977100 8:53205672-53205694 TTTTCTTTTCTTATAAGGACTGG - Intergenic
1042363785 8:67912570-67912592 GCTTATTTCCTTATAAGGAGGGG + Intergenic
1042503054 8:69530464-69530486 TTTTTATTTGTAATAAGGAGTGG - Intronic
1043765850 8:84131346-84131368 GTTTATATTCTCATAGGGAGAGG - Intergenic
1043766524 8:84140759-84140781 GTTTATATTCTTATAGGGAGAGG + Intergenic
1043784445 8:84380433-84380455 GTTAGTTTTATATTATGGAGAGG + Intronic
1045748727 8:105456168-105456190 GTTTTTTTTTTAAGAAGGAAGGG + Intronic
1045754863 8:105530630-105530652 ATTTGTGTCCTAATAAGAAGAGG - Intronic
1046409628 8:113823660-113823682 ATTTGTTTTCTGAGTAGGAGAGG - Intergenic
1046434519 8:114169660-114169682 TTTTGTTCTCAAATAAGAAGGGG - Intergenic
1046470794 8:114671136-114671158 GATTGTTTTCTTCTAAGAAGTGG + Intergenic
1047127387 8:121977277-121977299 GTTTGCTTTCTACTTAGGACTGG - Intergenic
1048237516 8:132706013-132706035 GTTTGTTCTCTTATAAAAAGAGG + Intronic
1048261019 8:132945050-132945072 GTTTTTATTCTAATAACGACTGG + Intronic
1048387490 8:133926049-133926071 GTTTATTTTATAATAGGGTGTGG + Intergenic
1048529525 8:135234798-135234820 TTTTGTTTTTTAATATGCAGAGG - Intergenic
1049037558 8:140088188-140088210 GCTTATATTCTAATGAGGAGAGG - Intronic
1050051123 9:1602550-1602572 GTCTGTTTGCTACCAAGGAGAGG + Intergenic
1052748655 9:32466435-32466457 ATTTATTTTCTAATAGGCAGAGG - Exonic
1053224802 9:36345324-36345346 TTTTGTTTTAAAATAAGGTGAGG - Intronic
1053588042 9:39480710-39480732 TTTTCTTTTCTAATTATGAGAGG - Intergenic
1054996178 9:71393032-71393054 ATTTGTTTTCTAGGAAGGACTGG + Intronic
1056505649 9:87255835-87255857 GTTTTGTTTCTAATAAACAGGGG + Intergenic
1056743375 9:89279570-89279592 GTTTGTGTTTTAATATGCAGTGG - Intergenic
1058316059 9:103568264-103568286 CTTTGTTTCCTAATAGGGAAAGG - Intergenic
1059551012 9:115228869-115228891 GACTGTATTCTAATAAGGAAAGG - Intronic
1059583475 9:115578391-115578413 GTTTGCTTTCTAAGCAGCAGAGG - Intergenic
1061771419 9:132926319-132926341 TTTTGTTTTCTAAAGAGGTGAGG - Intronic
1061777625 9:132976143-132976165 GGGTGTTTTCTAATAGGAAGCGG - Intronic
1187426883 X:19185844-19185866 GTTTGTTTTCTAATAAGGTAGGG + Intergenic
1188095648 X:26018216-26018238 GTATGTTTTTTAATATGGAAAGG + Intergenic
1188365960 X:29315332-29315354 GTTTTTTTTCTATCAAGGTGTGG + Intronic
1188798285 X:34493946-34493968 GTCTGTTTTTCAACAAGGAGAGG + Intergenic
1190064506 X:47230680-47230702 GATTGTTTTCTAAGCAGAAGAGG + Intergenic
1191100035 X:56716831-56716853 GTTTTTTTTTTAACAAGAAGGGG - Intergenic
1192160842 X:68786092-68786114 GTTTGTTTTAGAACAAGGAAGGG - Intergenic
1193145810 X:78074585-78074607 GTTTGTTTTTAAAGAAGGAAGGG - Intronic
1193996711 X:88374719-88374741 TTTTGTTTTCTAACGAAGAGTGG + Intergenic
1194214773 X:91116451-91116473 GTTAGTGTTCTACTGAGGAGGGG - Intergenic
1195049249 X:101081641-101081663 TTTTGTTTTCCATTAAGGAGTGG + Intronic
1196348114 X:114691814-114691836 ATTTTTTTTCTAAGAAGCAGTGG - Intronic
1196997869 X:121403577-121403599 GTTAGTTTTGAAAAAAGGAGAGG - Intergenic
1197403643 X:126025255-126025277 GTTTATTTTCTAAAAAGAACAGG - Intergenic
1197526544 X:127571049-127571071 GTTTGTTTTCTAAGAGGTTGGGG + Intergenic
1197950364 X:131889347-131889369 GTTAGTTTTTTAATAAGGTGAGG - Intergenic
1199474066 X:148227017-148227039 GTTGGTGTTCTTATAAGAAGAGG + Intergenic