ID: 960322544

View in Genome Browser
Species Human (GRCh38)
Location 3:116254093-116254115
Sequence AGAGTATTCCACATATATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 294}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960322544_960322547 1 Left 960322544 3:116254093-116254115 CCTAAATATATGTGGAATACTCT 0: 1
1: 0
2: 2
3: 26
4: 294
Right 960322547 3:116254117-116254139 TAAAGACAGGGACCATCACTTGG 0: 1
1: 0
2: 1
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960322544 Original CRISPR AGAGTATTCCACATATATTT AGG (reversed) Intronic
901556366 1:10034234-10034256 AGAGAATTCCAGTTATATTCTGG + Intronic
906898308 1:49804472-49804494 AGAGTATTCAACATTTATTATGG + Intronic
908826586 1:68138679-68138701 AGTGTAATCCATATATCTTTAGG - Intronic
908867940 1:68573103-68573125 TTAGGATTCCACATATAATTGGG + Intergenic
908909610 1:69058058-69058080 AGGGTTTTCCATAGATATTTGGG - Intergenic
909389196 1:75098987-75099009 AAATAATACCACATATATTTAGG - Intergenic
909828571 1:80156764-80156786 AGTGTATTCCACACATAAGTAGG + Intergenic
910239173 1:85068024-85068046 AGAGTATTCCACAGACCATTAGG + Intronic
910324139 1:85985162-85985184 AGAATATTCCAATTAGATTTGGG + Intronic
910995287 1:93097912-93097934 AGATTATTGCAGATTTATTTGGG + Intronic
911412164 1:97523439-97523461 AGTGTAATGCATATATATTTGGG - Intronic
912222667 1:107696176-107696198 ACAGTATTACACATATTTATGGG + Intronic
916157643 1:161871068-161871090 TGAGTAGTCAACATTTATTTAGG - Intronic
916863908 1:168836036-168836058 AGACTATTGCACATATCCTTAGG - Intergenic
917386260 1:174478905-174478927 AGAAGATTCCAAATATCTTTTGG - Intronic
917627065 1:176856972-176856994 TGAGTATTCCACACCTATTTTGG + Intergenic
918693221 1:187508810-187508832 CGAGTATTTTACATGTATTTAGG - Intergenic
920611845 1:207448135-207448157 AGACTATTCAACAAATAATTTGG - Intergenic
921593836 1:217033525-217033547 AGAATATTTCACATCTTTTTTGG - Intronic
923093176 1:230754819-230754841 AGTGGATTCCAAATATATATAGG - Intronic
1063260948 10:4388742-4388764 AGGGTTTTCCAGCTATATTTTGG + Intergenic
1063567248 10:7181412-7181434 AGGATATTCAACATGTATTTGGG + Intronic
1064772263 10:18735620-18735642 AGAGTATTCCACAATCATTAGGG + Intergenic
1065044002 10:21728924-21728946 ACAGTATTGCTGATATATTTGGG + Intronic
1065798696 10:29331358-29331380 AGAGTATTGGCCAGATATTTTGG + Intergenic
1066204442 10:33173776-33173798 AGATTAATCCACTAATATTTGGG + Intergenic
1067257272 10:44653884-44653906 AGAGTTTTAAAAATATATTTTGG + Intergenic
1068223454 10:54074418-54074440 ATATGATTCCACTTATATTTTGG - Intronic
1068344234 10:55750902-55750924 AGATTATTATACATATCTTTAGG + Intergenic
1069329457 10:67274503-67274525 AGATTATACCACATCTCTTTTGG + Intronic
1070204987 10:74249072-74249094 AGAGAATTTCACACAAATTTTGG - Intronic
1071389839 10:85161930-85161952 AGAGAATCTCACATATATGTGGG - Intergenic
1071548328 10:86545688-86545710 TCACTATTCCATATATATTTTGG - Intergenic
1072839221 10:98752031-98752053 AGTCTATTCCATGTATATTTTGG + Intronic
1075191662 10:120315262-120315284 TGAGGATTCCAGATACATTTTGG - Intergenic
1078787409 11:14508449-14508471 AGAGTAATCCAAGTAAATTTAGG - Intronic
1079503684 11:21131015-21131037 AGTCTAGTCCACATCTATTTAGG - Intronic
1079593897 11:22217300-22217322 TGAGTATCCCAGATATTTTTAGG + Intronic
1079600411 11:22305204-22305226 AGAGGACTCCACATAAATATGGG - Intergenic
1079722295 11:23832729-23832751 AGTGAATTACACATATTTTTGGG + Intergenic
1079725340 11:23873753-23873775 AGAAAAATACACATATATTTTGG - Intergenic
1079902324 11:26202798-26202820 AGAATTTTCAAAATATATTTAGG + Intergenic
1081015734 11:37877611-37877633 TGAATATTCCACATGTCTTTAGG - Intergenic
1082312926 11:50676141-50676163 ATAGTCTTCCACATATCTCTTGG + Intergenic
1082682079 11:56186821-56186843 AGAATATTCAGGATATATTTAGG + Intergenic
1085568134 11:77533993-77534015 AGAGTATTGCTGATATATATAGG + Intronic
1086857732 11:91886170-91886192 AGATTATTCAACTTATAATTAGG - Intergenic
1086947368 11:92856389-92856411 TGAGTATTTCACATGTAATTAGG - Intronic
1087727131 11:101733259-101733281 AAAATATTACACAGATATTTAGG + Intronic
1087729793 11:101766184-101766206 AGAGAATTCAACATTTATTCTGG - Intronic
1087892313 11:103549679-103549701 AGAGTCTTCCTCTTATCTTTGGG - Intergenic
1089589652 11:119532268-119532290 TGTCTATTCCACATACATTTGGG + Intergenic
1090861451 11:130656395-130656417 AGAGAATTCCAGAGATATTCAGG + Intergenic
1091673770 12:2472471-2472493 AGAGAATTCCACAAATAAATGGG - Intronic
1093382118 12:18505877-18505899 ACATCATTCCACAGATATTTAGG + Intronic
1093526630 12:20111124-20111146 AGAATATTCAACATATATTAAGG + Intergenic
1093682534 12:22018905-22018927 AAAGTATTTCAAATAAATTTTGG + Intergenic
1093767977 12:22986695-22986717 ACAGAATTCCACATTTATTAAGG + Intergenic
1093798505 12:23342891-23342913 AAAATATTCCACATATGTCTAGG + Intergenic
1093909497 12:24729797-24729819 AGAGTATCACAGATATCTTTTGG - Intergenic
1093954914 12:25205183-25205205 AAAGTATTCCATATCCATTTCGG + Intronic
1094082731 12:26555284-26555306 AGAGGTTTCCAGATCTATTTTGG + Intronic
1095408921 12:41900836-41900858 TGAGTCTTCCTTATATATTTTGG - Intergenic
1095484316 12:42668701-42668723 ATAGTATCTGACATATATTTAGG - Intergenic
1095484338 12:42669075-42669097 TGAGTAATCCACATCAATTTTGG - Intergenic
1098009754 12:66038067-66038089 AGAGTACTCCACCAAAATTTTGG + Intergenic
1098901573 12:76116762-76116784 AGAATATTCAACATAATTTTTGG - Intergenic
1099474892 12:83096202-83096224 TGATAATACCACATATATTTTGG - Intronic
1100219065 12:92484198-92484220 AGAGTCTTCTACGTAGATTTGGG + Intergenic
1101446713 12:104742203-104742225 AGAATATTCTACTTCTATTTTGG - Intronic
1102270845 12:111533822-111533844 AGCGTATTTCCCATATATTTTGG + Intronic
1104737855 12:131149930-131149952 AGAGTATACCACAGATATACAGG + Intergenic
1105072086 12:133240599-133240621 AGATTCTTTGACATATATTTTGG - Intergenic
1106056625 13:26243950-26243972 TGTGAATTCCTCATATATTTTGG - Intergenic
1107791893 13:44010900-44010922 AGATTTTTCCTCATATATATTGG + Intergenic
1109013436 13:56978407-56978429 AGATTTTTACACATAAATTTTGG - Intergenic
1109763688 13:66864659-66864681 AGAGAATTCCAGAGAAATTTTGG - Intronic
1110461654 13:75751871-75751893 AGAGTATTCCCTTTATATTTGGG + Intronic
1110480963 13:75975660-75975682 AGTGGATTCAAGATATATTTTGG + Intergenic
1110723459 13:78791821-78791843 AGAGTATACTAAAAATATTTCGG + Intergenic
1110815015 13:79851708-79851730 AGAGTAATCCTCAAAGATTTAGG + Intergenic
1116051313 14:39806863-39806885 GGGGTATTTCAAATATATTTTGG + Intergenic
1116736264 14:48696211-48696233 AGGTTCTTCCACATTTATTTGGG + Intergenic
1120459461 14:84776008-84776030 AGAATATTCAAAATGTATTTGGG + Intergenic
1120597529 14:86459957-86459979 AGAGAACTACACATGTATTTTGG - Intergenic
1120726529 14:87947996-87948018 TGAGTTTTCCACAAATGTTTAGG - Intronic
1122016667 14:98802405-98802427 AGAGGCATCCACACATATTTAGG + Intergenic
1124398578 15:29328905-29328927 AGGGTATTCCACACATATAAGGG - Intronic
1128409332 15:67378392-67378414 GCAGTCTTCAACATATATTTTGG + Intronic
1130023422 15:80250445-80250467 ATAATTTTCCACATGTATTTGGG + Intergenic
1132192663 15:99881712-99881734 AGTGTAGTCCATTTATATTTAGG - Intergenic
1133303908 16:4798456-4798478 AGAATATTCCACCTATAATCTGG + Intronic
1133389834 16:5401221-5401243 AATGAATTCCAAATATATTTAGG - Intergenic
1133829019 16:9304789-9304811 ACAGTATTCCACATTTCCTTGGG + Intergenic
1134425449 16:14139185-14139207 AGAGTTTTAAAAATATATTTTGG - Intronic
1135387088 16:22051995-22052017 AAATTATTCCACATATATATAGG - Intronic
1135475085 16:22767129-22767151 ATAATATTACACATATGTTTTGG - Intergenic
1137714109 16:50587416-50587438 GAAGTATTACACCTATATTTTGG - Intronic
1137784915 16:51130524-51130546 AGAGTATACCACATGTAGTAAGG - Intergenic
1138861300 16:60761345-60761367 ATAATATCCTACATATATTTAGG + Intergenic
1139313742 16:66050069-66050091 CGTCTATTCCACAAATATTTTGG + Intergenic
1140189637 16:72804441-72804463 AGAATATTCCAGATAATTTTAGG + Intronic
1140355881 16:74305992-74306014 AGAGAAGTCAACAAATATTTTGG + Exonic
1144163481 17:12584314-12584336 AGGGTGTTCCATACATATTTTGG + Intergenic
1144486601 17:15670716-15670738 AGATTATTCTACATACAATTAGG + Intronic
1144914419 17:18711571-18711593 AGATTATTCTACATACAATTAGG - Intronic
1145407110 17:22611019-22611041 AGATTATTATACATATCTTTAGG + Intergenic
1149099543 17:52887204-52887226 AGAGTTATCCCCATTTATTTAGG - Intronic
1150020166 17:61603565-61603587 AGACTATACCACATATAGTAAGG + Intergenic
1150193179 17:63265002-63265024 AGAGTATGGTAAATATATTTGGG - Intronic
1153718718 18:7879733-7879755 AGAGAATTCCACATGAATCTAGG - Intronic
1154045354 18:10899006-10899028 AGAGAATACAACATGTATTTAGG + Intronic
1155309659 18:24511062-24511084 ACAGTACCCCACATTTATTTGGG + Intergenic
1155631061 18:27893245-27893267 TGTGTATTCCTTATATATTTTGG - Intergenic
1156017830 18:32566235-32566257 ATTGTATTACAGATATATTTCGG + Intergenic
1156023328 18:32623960-32623982 AGAGTATGTCACAGATATTTGGG - Intergenic
1156714415 18:39989789-39989811 TCAGTGTTCCACATATATTTGGG + Intergenic
1156996193 18:43470133-43470155 AGAATCTTCAAAATATATTTAGG + Intergenic
1157070502 18:44402322-44402344 AGAGTAAGCCATATATATTGAGG + Intergenic
1158466264 18:57692750-57692772 AGAAAATTTCACCTATATTTGGG + Intronic
1158725986 18:59972672-59972694 AGAGTATCCCATAAATATCTTGG + Intergenic
1159311168 18:66711419-66711441 TGAATATTACAAATATATTTTGG - Intergenic
1159627684 18:70713862-70713884 AGTCTATTACACATATATTTGGG + Intergenic
1160532427 18:79573343-79573365 AGAATATCCCACATGTATTTAGG + Intergenic
1165585826 19:36915309-36915331 ACAGAATGCCACATACATTTAGG + Intronic
1166569010 19:43781753-43781775 AGAGAATTGCACATACATTGTGG + Intergenic
1167123443 19:47532755-47532777 AGATTTTTCCAAATATATGTAGG - Intronic
1167998773 19:53427854-53427876 TGAGTGTTCCTTATATATTTTGG + Intronic
1168355552 19:55697587-55697609 AGAGGCTTGCACATAAATTTGGG + Intronic
1168363250 19:55761002-55761024 AAAATATTCCTTATATATTTTGG + Intronic
1168364199 19:55771004-55771026 AAAATATTCCTTATATATTTTGG + Intronic
928047179 2:27947572-27947594 TGAGAATTCTTCATATATTTAGG + Intronic
928591401 2:32819379-32819401 AGCATATTTCACATATATTTGGG + Intronic
929213100 2:39381356-39381378 AGAGTTCTTCACATATATTCTGG + Intronic
930461074 2:51676940-51676962 AAAGCATTCCACATAAACTTTGG - Intergenic
930551839 2:52845248-52845270 AGAGTAAACCTCATACATTTTGG - Intergenic
931065071 2:58576928-58576950 AGAGTTTTCCAAGTAGATTTGGG - Intergenic
932960056 2:76403081-76403103 AGACTAAACCACAGATATTTAGG + Intergenic
933115380 2:78462963-78462985 AGAGTTTACCTAATATATTTTGG - Intergenic
933125071 2:78594171-78594193 AGAGTATTCCAGATCTTGTTCGG - Intergenic
934092399 2:88563704-88563726 ATAGTATTCAACATTCATTTGGG - Intronic
935745925 2:106190279-106190301 AGATTATACCACATCTATATAGG + Intronic
936647823 2:114392138-114392160 AAAATATGCCAAATATATTTTGG - Intergenic
939088002 2:137744667-137744689 AAAGTAACACACATATATTTTGG - Intergenic
939608230 2:144278365-144278387 AGAATACTCAACATATATTAGGG + Intronic
939639321 2:144620084-144620106 AATGTATTACACATATTTTTAGG + Intergenic
939677552 2:145091312-145091334 AGATTATTCCACAAATATGAAGG + Intergenic
939897903 2:147814149-147814171 AGAGTTTTCCTGATTTATTTTGG - Intergenic
939969993 2:148647203-148647225 TTAGTATGCCACATATGTTTTGG + Intronic
941177605 2:162217970-162217992 AAAGTATTCAACATACCTTTGGG + Exonic
941609297 2:167641204-167641226 AGAATATTCCACATAGATAGAGG - Intergenic
942510413 2:176693121-176693143 AGAGTAATGAACATATGTTTGGG - Intergenic
943172467 2:184420702-184420724 TGAGTAATTCACATAGATTTTGG + Intergenic
943190831 2:184678782-184678804 ATAGTGTTACACATACATTTTGG - Intronic
943506764 2:188770241-188770263 AGCCTATTCCACTTGTATTTCGG + Intronic
944470197 2:200045113-200045135 ATTGTAATCCACATATATTGTGG - Intergenic
946681391 2:222220724-222220746 ATATTATTACACAAATATTTAGG - Intronic
1169837945 20:9901268-9901290 ATACTATTGTACATATATTTGGG + Intergenic
1174241122 20:49135737-49135759 AGATTATTCCAATGATATTTAGG + Intronic
1174924176 20:54739006-54739028 AAAGTGTGCCACTTATATTTTGG + Intergenic
1177324464 21:19566722-19566744 GGGGTATTCCACAAAGATTTGGG - Intergenic
1177818850 21:26009205-26009227 AAAGAAGTACACATATATTTGGG + Intronic
1177819841 21:26019043-26019065 AGAGGATGCCACATAAACTTAGG - Intronic
1178333479 21:31722066-31722088 AGAGTATTGCCAAAATATTTTGG - Intronic
1179665527 21:42909488-42909510 TGATTATCCAACATATATTTTGG + Intronic
1181942944 22:26492803-26492825 AAAGAAGTTCACATATATTTAGG + Exonic
1182997722 22:34829798-34829820 AGAGTGTTCTACCTATTTTTAGG - Intergenic
1184494233 22:44828202-44828224 TGTGTGTTCCAGATATATTTGGG - Intronic
949620590 3:5807288-5807310 AGACTTGTCCACATAGATTTTGG - Intergenic
950573059 3:13813931-13813953 AGAATCTTCCACATATTTTGGGG - Intergenic
953579287 3:44138953-44138975 AGATTATTCCACATAAATACTGG + Intergenic
958391272 3:93470397-93470419 AGAGTATAAAATATATATTTGGG + Intergenic
959196643 3:103191905-103191927 AGAGTTTTGCACATATATTAAGG + Intergenic
960321014 3:116236172-116236194 AGAATAATGAACATATATTTTGG - Intronic
960322544 3:116254093-116254115 AGAGTATTCCACATATATTTAGG - Intronic
961973933 3:131002374-131002396 AGAATCTTCCACATATACTCTGG - Intronic
963617524 3:147560610-147560632 CTATCATTCCACATATATTTAGG + Intergenic
963752160 3:149193047-149193069 AGAGTATACCACATACAGTAAGG - Intronic
963952201 3:151215002-151215024 AGTGTATTCTACATATATGTTGG + Intronic
964296238 3:155236850-155236872 AGAGTTTTCCATATATCTGTGGG + Intergenic
965196101 3:165597080-165597102 AAAGTATTGGACATATAGTTTGG - Intergenic
965722744 3:171679761-171679783 AAACTATTCCACATAAATTAGGG + Intronic
966075317 3:175929397-175929419 AGATTATTCAACATTTCTTTCGG - Intergenic
967678064 3:192324248-192324270 AGAGTATTTCTCATCTAATTAGG - Intronic
967808487 3:193735644-193735666 AGAGCATAACACAAATATTTAGG + Intergenic
969632058 4:8344501-8344523 AGAGCATGCCACACATATTTGGG + Intergenic
970375370 4:15451689-15451711 AGAATATCCCACATTTATTAAGG - Intergenic
971045741 4:22803143-22803165 AGAGCATTTGACATACATTTAGG - Intergenic
971125812 4:23752721-23752743 ATAGTGTTTCAGATATATTTTGG - Intergenic
973207487 4:47576375-47576397 AGAGGATTTCATATAAATTTTGG + Intronic
975404172 4:73969625-73969647 AGAGTCTTTCACTTATCTTTTGG - Intergenic
975859156 4:78657903-78657925 AGAGTAGCCCAGAAATATTTGGG - Intergenic
975927835 4:79480302-79480324 AGAGTTTGCTTCATATATTTAGG + Intergenic
977417819 4:96757443-96757465 AGAATATTTTACATATATATGGG + Intergenic
977817781 4:101435424-101435446 ATACTATTTCACATATTTTTGGG + Intronic
978053690 4:104236292-104236314 AGGGTAGTCCACTTTTATTTGGG - Intergenic
978286853 4:107089071-107089093 ATTGCATTCCACATATATTGTGG + Intronic
979001299 4:115223705-115223727 AGAATATGACACATGTATTTAGG - Intergenic
979011322 4:115373752-115373774 AGAATATTCCTCATTAATTTAGG - Intergenic
979650387 4:123123538-123123560 AGAGTATACCAGATATTTTGAGG - Intronic
980709751 4:136549568-136549590 AGAGAAATTCACATAGATTTGGG - Intergenic
980839128 4:138236383-138236405 AGGTCATTACACATATATTTTGG - Exonic
980884256 4:138745084-138745106 AGATTCTTCCATTTATATTTAGG - Intergenic
981364177 4:143882768-143882790 AGTGTAATCCACTTACATTTAGG + Intronic
981385235 4:144122856-144122878 AGTGTAATCCACTTACATTTAGG + Intronic
982199656 4:152948003-152948025 AGAGCATTTCAAATACATTTGGG + Intronic
983271302 4:165565085-165565107 ACAGAATTCAACAAATATTTAGG - Intergenic
983732915 4:171019843-171019865 ATAGTATTTCATATATATTAAGG + Intergenic
983866511 4:172773456-172773478 AGAATATTCTGCATAAATTTTGG - Intronic
984275282 4:177602042-177602064 ATAGATTTCCACATTTATTTAGG - Intergenic
987911563 5:24154081-24154103 AATGTATTCCTCATATTTTTAGG - Intronic
988078478 5:26383697-26383719 AGTATATTCCAGGTATATTTTGG + Intergenic
988339729 5:29955224-29955246 AGATTAAGCCACATATATTTTGG + Intergenic
989410884 5:41119200-41119222 AGAGGATTCAAAATATATTTTGG - Intergenic
990215601 5:53528647-53528669 ATGGTATTCCACAAATCTTTGGG + Intergenic
990306018 5:54494561-54494583 AGAGAAATCCCCACATATTTCGG + Intergenic
990621119 5:57559759-57559781 AGAGTTTTCTAAATATATTCTGG + Intergenic
991316580 5:65315577-65315599 ATGGTATTCAACATATAGTTGGG - Intronic
991368785 5:65896469-65896491 AGAGGATTTGAAATATATTTAGG + Intergenic
993441797 5:87965872-87965894 AGAGTATTAAAAATATTTTTTGG + Intergenic
994769585 5:103965019-103965041 AAGGAATTCCACATATATTTTGG + Intergenic
996601464 5:125269115-125269137 AGAGTTTTCCATGTATTTTTTGG - Intergenic
996992174 5:129648568-129648590 ATTTTATTCCTCATATATTTTGG + Intronic
997035179 5:130181964-130181986 AAATTATTCTATATATATTTAGG + Intronic
998603719 5:143612129-143612151 GGGGGGTTCCACATATATTTTGG + Intergenic
999741492 5:154557877-154557899 AGAGAAATCCACAAATATGTAGG - Intergenic
999960518 5:156751022-156751044 TGGGTCTTCCACATACATTTTGG - Intronic
1000896022 5:166856693-166856715 AGACTATTCCACTTATGTATAGG + Intergenic
1002121826 5:177010863-177010885 AGAGCATTACAGATATATTAAGG - Intronic
1002799310 6:505951-505973 ATAGAATTCTACATATATTTAGG - Intronic
1003788024 6:9509598-9509620 ATATTATTGCATATATATTTGGG - Intergenic
1005891034 6:30138334-30138356 AGAATATCCAAGATATATTTTGG + Intronic
1008300472 6:49831970-49831992 AGTGTATTCCAAATATAGTTAGG - Intergenic
1008449703 6:51636131-51636153 AGAGGATTCCATAAATACTTGGG + Intronic
1009317942 6:62246354-62246376 AGAGTATCTCAGATATATGTTGG - Intronic
1009432010 6:63574192-63574214 AGTCTGTTCCACATCTATTTAGG - Intronic
1009743795 6:67785519-67785541 ACAGTATTCCACAGATATCTTGG + Intergenic
1010542457 6:77108866-77108888 ATTTTATTGCACATATATTTTGG - Intergenic
1010628239 6:78165587-78165609 ATAGTTTTTGACATATATTTTGG - Intergenic
1011524130 6:88244627-88244649 AGAGTATTAAACTGATATTTTGG - Intergenic
1012943782 6:105444538-105444560 AGACCATTCCACATAAATTTAGG - Intergenic
1012962139 6:105633340-105633362 CAAGTATTCCTTATATATTTGGG - Intergenic
1013865829 6:114694939-114694961 TGAGTGTTCCACTCATATTTTGG + Intergenic
1014502304 6:122205866-122205888 AGACTTTACAACATATATTTGGG - Intergenic
1014733154 6:125058218-125058240 AGAGTATTGCTCTTTTATTTTGG + Intronic
1014846177 6:126279965-126279987 AGGATGTTCCACAAATATTTTGG + Intergenic
1015689652 6:135907722-135907744 AGAGTATTACATGTATTTTTAGG - Intronic
1016903465 6:149125592-149125614 AAAGGATTCCACATATAAGTGGG - Intergenic
1018108768 6:160514375-160514397 ACTGTATTGCATATATATTTAGG - Intergenic
1020955717 7:14738155-14738177 GAAGTATTCCACATTCATTTGGG + Intronic
1024949402 7:54843365-54843387 AGAGTATTCCATTCATATATTGG - Intergenic
1025578387 7:62677795-62677817 ATAGTCTTCCAAATATATCTTGG - Intergenic
1025964921 7:66260459-66260481 AGATTATTCCACAGTTATTATGG - Intronic
1028370827 7:90090119-90090141 AGAGTATTCCACAAATACAGTGG - Intergenic
1029852108 7:103473148-103473170 AGAGAATTTCACATATTTTCTGG - Intronic
1029950015 7:104573895-104573917 ATAGTATTCCACTTTAATTTTGG + Intronic
1030483539 7:110135877-110135899 TGAATATTCCACAACTATTTCGG - Intergenic
1031185191 7:118470241-118470263 AGTGTTTTCAACATATTTTTTGG - Intergenic
1032220690 7:129991866-129991888 AAAGTATTCCACAGCTACTTGGG - Intergenic
1033439186 7:141363331-141363353 AGTCTATTGCACATATCTTTTGG + Intronic
1033567016 7:142588504-142588526 AGAGTATTCCAAGAAGATTTGGG + Intergenic
1036136998 8:6171462-6171484 TGAGTTTTCCACAATTATTTTGG - Intergenic
1037038702 8:14203194-14203216 AGACTAATACAGATATATTTAGG + Intronic
1037437354 8:18876698-18876720 AGAGAATAACAAATATATTTAGG - Intronic
1037482925 8:19321703-19321725 AGAGTTTTTCAGATATAATTGGG + Intronic
1041150845 8:54932173-54932195 AGATTATAACATATATATTTAGG - Intergenic
1042610863 8:70599307-70599329 ATAGTATACCACATTTAGTTGGG - Intronic
1043333377 8:79144483-79144505 AGATTTTTCCACATATCTATTGG + Intergenic
1045677237 8:104620733-104620755 AGAGTATTCTAAGTATATTTTGG + Intronic
1046079090 8:109349005-109349027 TGAGTCTTACACTTATATTTGGG + Intergenic
1046458542 8:114503514-114503536 AGTGAAATCTACATATATTTAGG - Intergenic
1046754785 8:117962217-117962239 AGAGTATTCCAAATAGATAATGG - Intronic
1047350026 8:124064868-124064890 AGTGTGTTCCACAAATATTTAGG + Intronic
1048527226 8:135214259-135214281 ATAGTATTCCACAAAAATTCAGG + Intergenic
1048653060 8:136502462-136502484 AGACTGGTCCACATATTTTTAGG + Intergenic
1048656077 8:136537594-136537616 ATAGTGTTCCTCAAATATTTTGG + Intergenic
1049861895 8:144904471-144904493 GGAGAAATCCCCATATATTTTGG - Intergenic
1050538405 9:6649512-6649534 GGAGAAATCCCCATATATTTCGG + Intergenic
1051088242 9:13377106-13377128 AGAAAATTCAAAATATATTTAGG + Intergenic
1051254474 9:15199036-15199058 AGTGTTTGCCTCATATATTTAGG - Intronic
1051763752 9:20499296-20499318 TTAGGATTCAACATATATTTGGG + Intronic
1052522972 9:29573357-29573379 TTAGTAGTCCAAATATATTTTGG + Intergenic
1053486781 9:38463729-38463751 AGAGTTTTAAAAATATATTTTGG + Intergenic
1055314129 9:75016466-75016488 AGAGTAATCCACTTATATTATGG + Intronic
1056344350 9:85675675-85675697 ATAGAATTCCTCATAAATTTTGG + Intronic
1056882028 9:90404033-90404055 AGAGTATTCCACAAGTATTTGGG + Intergenic
1056999249 9:91492533-91492555 ATAGCATTTCACAAATATTTGGG - Intergenic
1057817770 9:98308235-98308257 AGAGTAGCCCACATTTATTGTGG - Intronic
1058832824 9:108834208-108834230 AAAGTATTTCATATATAATTAGG - Intergenic
1059893902 9:118837613-118837635 AAATTATTCCAGATATATTTGGG + Intergenic
1203378146 Un_KI270467v1:2279-2301 ACAGTATACAATATATATTTTGG + Intergenic
1203378162 Un_KI270467v1:2733-2755 ACAGTATACAATATATATTTGGG + Intergenic
1203378185 Un_KI270467v1:3321-3343 ACAGTATACAATATATATTTTGG + Intergenic
1203378208 Un_KI270467v1:3822-3844 AGAGTATATAATATATATTTTGG + Intergenic
1186969901 X:14830556-14830578 AGTGTATTGCAGAGATATTTAGG - Intergenic
1187720631 X:22147179-22147201 AGTGAATTCCTCATATAATTTGG - Intronic
1187726286 X:22205949-22205971 AGAATATTCCACTTTTATTGGGG + Intronic
1188116108 X:26244565-26244587 AGGGTATTCAACAGGTATTTTGG - Intergenic
1188896114 X:35670464-35670486 AGATTATTCCAGATACAATTTGG + Intergenic
1188898301 X:35697052-35697074 AGAATATTTGACAAATATTTAGG - Intergenic
1189290508 X:39881994-39882016 AGACAATTCCACAAACATTTTGG + Intergenic
1189293633 X:39903586-39903608 AGGGAATTCCTCACATATTTTGG + Intergenic
1189700462 X:43713496-43713518 CTAGTATTCCACATCTATATGGG - Intronic
1191125756 X:56952430-56952452 GGTGTATTGCATATATATTTAGG + Intergenic
1192162850 X:68801528-68801550 TGAGTGTTCAACAAATATTTTGG - Intergenic
1192875397 X:75224285-75224307 AGAGTATGACACATATATTTGGG - Intergenic
1193369497 X:80677446-80677468 ATTGTATTCCACATATTTTTGGG - Intronic
1193620239 X:83744135-83744157 AGTGTATTCTTGATATATTTGGG + Intergenic
1193767911 X:85554709-85554731 AAGGTTTGCCACATATATTTAGG + Intergenic
1194081784 X:89476197-89476219 AAAGTATATCACATATATTAAGG - Intergenic
1195277698 X:103298451-103298473 ATAGTCTACCAAATATATTTGGG + Intergenic
1195496869 X:105546364-105546386 CGAGAATTCCATATTTATTTAGG + Intronic
1196335707 X:114530771-114530793 TAAATATTCCACATATATATCGG - Intergenic
1196387180 X:115170204-115170226 TGAGTGTTCCGAATATATTTAGG - Intronic
1196405180 X:115353789-115353811 GCAGTATTGCTCATATATTTTGG - Intergenic
1197019539 X:121669864-121669886 AGTGTATTCCAGGGATATTTAGG + Intergenic
1197327446 X:125111035-125111057 CGATTATTCAACAAATATTTAGG - Intergenic
1197529660 X:127607073-127607095 AGAGTCTTCCAAATAGATTCTGG + Intergenic
1197995548 X:132368601-132368623 AGACTATTCCATAGATATTGAGG + Intergenic
1199918501 X:152371101-152371123 AGATTTTTCCAGATATATTAAGG - Intronic
1200434453 Y:3132387-3132409 AAAGTATATCACATATATTAAGG - Intergenic
1200975501 Y:9208274-9208296 AGACTTTTACAAATATATTTAGG + Intergenic
1201336410 Y:12885403-12885425 AGAGTATTCTGCATGTCTTTTGG + Intergenic