ID: 960327020

View in Genome Browser
Species Human (GRCh38)
Location 3:116309798-116309820
Sequence TGACATCTGGTTACAATAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 147}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960327017_960327020 23 Left 960327017 3:116309752-116309774 CCTAGAATCAGAACAAGGAAGGT 0: 1
1: 0
2: 3
3: 18
4: 245
Right 960327020 3:116309798-116309820 TGACATCTGGTTACAATAGCTGG 0: 1
1: 0
2: 0
3: 16
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960327020 Original CRISPR TGACATCTGGTTACAATAGC TGG Intronic
901388785 1:8929026-8929048 AGACATCTGGTGGCAATTGCTGG + Intergenic
902062913 1:13660205-13660227 TGACAACTGGATACAAAAGCTGG + Intergenic
903097146 1:20988322-20988344 TGACATCTTGTTTCAATAGATGG - Intronic
906558792 1:46738111-46738133 TGACATCTTCTTCCAATAGAAGG + Intergenic
907610410 1:55864232-55864254 TGACATCTTGTTTTAATAGAAGG - Intergenic
909009308 1:70316099-70316121 TAACACCTGGTAACAATTGCAGG - Intronic
909530059 1:76672144-76672166 GGACATCTGCTTTGAATAGCAGG - Intergenic
911043302 1:93608723-93608745 TGGGATCTGGTTTCAATATCAGG - Intronic
911520577 1:98925224-98925246 TGACATCTGGTTAACCTAGATGG - Intronic
911758462 1:101588544-101588566 TGACATCTGGTGAAATTAGAAGG + Intergenic
912927783 1:113929140-113929162 TGACATCTGTGTACCATATCTGG - Intergenic
913496306 1:119431299-119431321 TGACATCTGGTAACCATGGAGGG - Intergenic
917069897 1:171139087-171139109 CGACAACTGATTACAATGGCTGG - Intronic
917115414 1:171598396-171598418 TGGCATCTGCTTCCAATAGAAGG - Intergenic
922664060 1:227453970-227453992 TGATATCGGGGTACAAAAGCTGG + Intergenic
923318912 1:232809825-232809847 AAACATCTAGTTACAATACCTGG - Intergenic
1063039671 10:2324227-2324249 TGGCATCTTCTTCCAATAGCAGG + Intergenic
1063788603 10:9413473-9413495 TGGCATCTTTTTACAATAGAAGG - Intergenic
1063881251 10:10535311-10535333 TGCCCTCTGGTTCCCATAGCAGG + Intergenic
1065228996 10:23577694-23577716 TGACATTTGGCTAAAAGAGCTGG + Intergenic
1066341319 10:34536792-34536814 TGACTTCTGCTTAGAAGAGCAGG - Intronic
1068904931 10:62312084-62312106 TGAAATGTGGATACAATATCTGG - Intergenic
1069608748 10:69758060-69758082 TGGCATCTGGGTTCAATTGCAGG - Intergenic
1072889694 10:99312261-99312283 TGACATCTGGTTCCAAGAGAAGG - Intergenic
1073502606 10:103954800-103954822 AAATATCTGGTTACAATAACTGG + Intergenic
1073819439 10:107244147-107244169 TGAGATCTGGTTCCTAAAGCAGG + Intergenic
1075168276 10:120089181-120089203 TGACATCTTCTTCCAATAGAAGG - Intergenic
1080528919 11:33154885-33154907 TGACATCTGGTCCTAATATCCGG - Intronic
1081301809 11:41461264-41461286 TGACATCTGCTGGCAATACCTGG - Intergenic
1084300069 11:68243569-68243591 TGTCATCTGGTTTCAGTATCAGG - Intergenic
1085530016 11:77186383-77186405 TGACATCTTCTTCCAATAGAAGG + Intronic
1085724883 11:78946101-78946123 TGACATCTTCTTCCAATAGAAGG - Intronic
1085844851 11:80053257-80053279 TGGAATCTGGTTACAAGAGCTGG - Intergenic
1086616758 11:88830932-88830954 TGAGATCTGGTTACTATAATGGG - Intronic
1087735982 11:101834475-101834497 TGACATCTTCTTCCAATAGAAGG - Intronic
1088754423 11:112873904-112873926 TGACATCTGATTACATTTGATGG - Intergenic
1089836386 11:121374146-121374168 TGACATCTGGTAACAACGGAGGG - Intergenic
1092772345 12:11909033-11909055 TGACATATGGCCAGAATAGCTGG + Intergenic
1093518393 12:20018614-20018636 TGACGTCTGTTTATAATAGGAGG + Intergenic
1093636384 12:21475041-21475063 TGACATATGGTAAAATTAGCAGG + Intronic
1100963496 12:99988438-99988460 AGACATCTGGATAGAAGAGCAGG + Intergenic
1101685142 12:107011847-107011869 TGACATCTTCTTCCAATAGAAGG - Intronic
1101706723 12:107227432-107227454 TGACAGCTGGTTAGAAATGCAGG + Intergenic
1102341974 12:112128502-112128524 TGACATCTTGTTTAAAAAGCAGG + Intronic
1104144030 12:126015577-126015599 AGACATCTTCTTACAATAGCAGG + Intergenic
1106537515 13:30660323-30660345 TGAGAGCTGGTGCCAATAGCAGG + Intronic
1106715043 13:32379244-32379266 AGCCATCTAGTTACAATAGATGG + Intronic
1108671283 13:52691698-52691720 TGTCATATGGTTACAGTAGCAGG - Intronic
1109875446 13:68397423-68397445 GGACTTCTGGTTACGATGGCAGG + Intergenic
1110749838 13:79100476-79100498 AGACATCTGTTTGCAATTGCAGG - Intergenic
1111278416 13:85984520-85984542 TGACATCTTCTTCCAATAGAAGG + Intergenic
1111487070 13:88917674-88917696 TGACATCTTCTTCCAATAGAAGG + Intergenic
1115136359 14:30113406-30113428 TGACATCTTCTTCCAATAGAAGG - Intronic
1117074193 14:52085080-52085102 TGACATCTTCTTTCAATAGAAGG + Intergenic
1118710746 14:68517435-68517457 TGACATCTGGGTAAAATTGCTGG - Intronic
1125418654 15:39479661-39479683 TGCCATCTGTTTTAAATAGCAGG - Intergenic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1132380070 15:101360253-101360275 TGACAGCTGGTCAGAATAGACGG - Intronic
1137804776 16:51294604-51294626 TGGCATCTTCTTACAATAGAAGG + Intergenic
1139507555 16:67406768-67406790 TCTCATCTGGTAACAATATCAGG + Intronic
1140965167 16:79958931-79958953 TGTCATCTGCTTACATTAGATGG - Intergenic
1146291807 17:31613055-31613077 TGAAATGTGGGTGCAATAGCTGG + Intergenic
1150948035 17:69768494-69768516 TGACATCTTCTTCCAATAGAAGG - Intergenic
1153739009 18:8103298-8103320 TGGCATCTGCTTCCAATAGAAGG + Intronic
1157325385 18:46665167-46665189 TCATATCTGGTTACACTTGCTGG + Intergenic
1158582204 18:58693506-58693528 TGACATCTTCTTCCAATAGAAGG - Intronic
1160287165 18:77554457-77554479 TGCCATTGGGTTAAAATAGCAGG + Intergenic
1164261070 19:23569133-23569155 TAACCTCTGGTTACAAAACCAGG + Intronic
1164295047 19:23902580-23902602 TGAAATCTGGCCACAAGAGCTGG + Intergenic
1164940304 19:32247251-32247273 TGACATCTTCTTCCAATAGAAGG - Intergenic
925725712 2:6869006-6869028 TGAGATTTGGTTACTATAGCTGG + Intronic
926843776 2:17110885-17110907 TGACATCTTGTTATAGCAGCTGG - Intergenic
930284520 2:49411189-49411211 AAACATCTGGTTAGAGTAGCAGG + Intergenic
933436758 2:82259229-82259251 TGACATCTGGGTTCAATTCCTGG - Intergenic
935949374 2:108314817-108314839 TCACACCTGGTTACAAAAGCAGG + Intergenic
941597596 2:167497098-167497120 TGATATTTTGTTATAATAGCTGG + Intergenic
943291401 2:186077266-186077288 TGATATCTGGTTACTCTCGCAGG + Intergenic
943740784 2:191405974-191405996 TGGCATCTTCTTCCAATAGCAGG + Intronic
945041689 2:205747967-205747989 TGACATCTGGTTTCAATTTCAGG + Intronic
945791604 2:214311548-214311570 TGACAAAAGGTTACAATAGGGGG - Intronic
947439481 2:230106581-230106603 TGCCATCTGTTTAAAATAGTGGG - Intergenic
948728284 2:239947738-239947760 TGCCATCTGGCAACAAGAGCTGG - Intronic
1169789813 20:9397913-9397935 TGTCATCTGCTGACAAAAGCAGG - Intronic
1172515668 20:35531102-35531124 TGAGTTCTGGTTTCAATAACTGG - Intergenic
1173313317 20:41920227-41920249 TGACATCTTCTTCCAATAGAAGG + Intergenic
1175250442 20:57606525-57606547 TGACATCTTTTTTCAATAGAAGG - Intronic
1179067168 21:38036369-38036391 TGACATCTGGGAAGAAGAGCAGG - Intronic
1179354771 21:40649135-40649157 CTACATCTGGTTACAAAAGAAGG + Intronic
1181394555 22:22610537-22610559 TGGCATCTTATTACAATAGCAGG + Intergenic
1182201745 22:28578886-28578908 GGAACTCTGGTTCCAATAGCTGG - Intronic
1184832113 22:46995463-46995485 TGACATCTCCTAACAAGAGCAGG - Intronic
952342387 3:32457062-32457084 TGGCAGCTGGTTAGAATTGCAGG + Intronic
953256399 3:41294580-41294602 TGACTTCTGGTCAAAATGGCCGG + Intronic
959109736 3:102107970-102107992 TGACATCTTCTTCCAATAGAAGG + Intronic
960327020 3:116309798-116309820 TGACATCTGGTTACAATAGCTGG + Intronic
962157383 3:132962284-132962306 TGACATCTTCTTCCAATAGAAGG + Intergenic
963081324 3:141397072-141397094 TGACATCTCCTTCCAATAGAAGG + Intronic
966734304 3:183176710-183176732 TGACAGCTGGTTCCAGTAGCGGG + Intergenic
967147224 3:186616466-186616488 TGCCATCTAGTTTCAACAGCTGG - Exonic
972175911 4:36406028-36406050 TGCCTTCTGGGTACTATAGCAGG + Intergenic
972214763 4:36884025-36884047 TGAAATATGGTTATAATGGCTGG - Intergenic
974397084 4:61351458-61351480 TGGCATCTTCTTCCAATAGCAGG - Intronic
974448756 4:62022494-62022516 TGGCATCTTGTTCCAATAGAAGG - Intronic
974859258 4:67499309-67499331 TGACATCTTCTTTCAATAGAAGG + Intronic
977310908 4:95386080-95386102 TGACTGCAGGTTACAATGGCTGG - Intronic
977568029 4:98601321-98601343 TGGCATCTTCTTCCAATAGCAGG + Intronic
981439301 4:144764804-144764826 TGACATCTTCTTCCAATAGAAGG + Intergenic
981651840 4:147069216-147069238 TGACATCTGGTTGCAAACACAGG - Intergenic
989524326 5:42435830-42435852 TGCTATCTGGTTACAAAGGCCGG - Intronic
990638474 5:57756345-57756367 TGATAATTTGTTACAATAGCAGG + Intergenic
990934920 5:61137924-61137946 GTACATCTGGTTGAAATAGCTGG + Intronic
992422727 5:76622726-76622748 AGTCATCTGCTTTCAATAGCTGG - Intronic
992820889 5:80494844-80494866 TGGCATCTTCTTACAATAGAAGG - Intronic
993562934 5:89434182-89434204 TAACATCTGTTTATAATTGCTGG + Intergenic
993596245 5:89859565-89859587 TGACATCTTCTGCCAATAGCAGG + Intergenic
996673256 5:126144286-126144308 TGACATCTCCTTCCAATAGAAGG - Intergenic
997855739 5:137370956-137370978 TCACAGCTGGTCACAGTAGCTGG + Intronic
999675077 5:153991423-153991445 TGCCTTCTGGTTACAAAGGCTGG - Exonic
1007379779 6:41480901-41480923 TGTCATCTTCTTACAATAGAAGG - Intergenic
1007801728 6:44400190-44400212 TGACATCTGGTTGCACTCTCAGG + Intronic
1007926912 6:45657083-45657105 TGAGATTTGGTTGCAATGGCTGG - Intronic
1009848326 6:69162943-69162965 TGACATCTAGTTTCAACAGCAGG + Intronic
1011737315 6:90324361-90324383 TGACATCTTCTTCCAATAGAAGG + Intergenic
1012287602 6:97411671-97411693 TGACATCTTCTTTCAATAGAAGG + Intergenic
1013027216 6:106287690-106287712 TGACATCAGGTGAAAATAGTGGG - Intronic
1013404297 6:109829588-109829610 TCACCTATGGTTACAATAGCTGG + Intergenic
1013739848 6:113269618-113269640 TGACATCTTCTTCCAATAGAAGG - Intergenic
1015178927 6:130340810-130340832 AGATGACTGGTTACAATAGCAGG - Intronic
1016163091 6:140906605-140906627 TTGCATCTGCTTAAAATAGCAGG + Intergenic
1016303422 6:142656940-142656962 TGACATCTTTTCACAAAAGCCGG + Intergenic
1018224210 6:161612273-161612295 TGACATCTTCTTCCAATAGAAGG - Intronic
1022594611 7:31700606-31700628 TGGCATCTTGTTCCAATAGAAGG - Intronic
1025769672 7:64492174-64492196 TGACATCTGGTAACCACAGAGGG - Intergenic
1031365848 7:120900185-120900207 TTACCTCTGGCTATAATAGCTGG - Intergenic
1032449073 7:132012779-132012801 GGACATCTTGTTACAATACAAGG - Intergenic
1032701702 7:134386142-134386164 TGACATCTTCTTCCAATAGAAGG - Intergenic
1033313994 7:140282935-140282957 TGCCATCTTGTTTCCATAGCTGG - Intergenic
1034010260 7:147521927-147521949 TGGCATTTGGTTACAGTAGCTGG - Intronic
1039076754 8:33697164-33697186 TGACATCTTCTTCCAATAGAAGG + Intergenic
1039155242 8:34548221-34548243 TAACATCTGCTTACAAGACCTGG - Intergenic
1039299140 8:36190685-36190707 TGACATATGGTCACACTACCAGG - Intergenic
1042294008 8:67200631-67200653 TCCCATCTGTTTACATTAGCTGG + Intronic
1044465381 8:92497691-92497713 TGACATCTGGGAACAAGGGCAGG + Intergenic
1045670346 8:104544441-104544463 TGACATCTTCTTCCAATAGAAGG - Intronic
1046802726 8:118447147-118447169 TGACATCTGGATACATTTGAGGG - Intronic
1047886225 8:129252968-129252990 TCAAATCTGGTTGCAATGGCTGG + Intergenic
1048207381 8:132426207-132426229 TGACATCTGGTGAAACTGGCAGG + Intronic
1049247799 8:141571968-141571990 TGCCATGTGGTCCCAATAGCAGG - Intergenic
1055967437 9:81879363-81879385 TGACCTCTGGCTACATTACCAGG - Intergenic
1057984540 9:99698462-99698484 TGTCATCTGCTTCCAATAGAAGG - Intergenic
1060171205 9:121462704-121462726 TGACATGTGGGCACAAAAGCCGG + Intergenic
1187292817 X:17971736-17971758 TGAAATCAGGTTAAAATAGATGG - Intergenic
1188628533 X:32319469-32319491 AGATATGTGGTTACAATTGCTGG + Intronic
1190171918 X:48118025-48118047 TGGCATCTGCTTCCAATAGAAGG + Intergenic
1190587943 X:51965670-51965692 TGTCATCTGTTTAAAATAGTGGG - Intergenic
1190939440 X:55026430-55026452 TGACATATGTTTGCATTAGCAGG - Intronic
1191191804 X:57675831-57675853 TGACATCTGGTAACAACAGAGGG - Intergenic
1197456321 X:126680200-126680222 TGGCATCTTCTTACAATAGAAGG + Intergenic
1199028383 X:142967201-142967223 TGAAATCAGGTTACAAGAGTGGG - Intergenic
1199246071 X:145605309-145605331 TGTTATCTGGTTAAAATAACGGG + Intergenic
1201682658 Y:16665914-16665936 TCACAGCTGGTTACACTAGAAGG + Intergenic
1202258702 Y:22946696-22946718 TAACATCTGTTTGCTATAGCAGG - Intergenic
1202411691 Y:24580454-24580476 TAACATCTGTTTGCTATAGCAGG - Intergenic
1202459091 Y:25089618-25089640 TAACATCTGTTTGCTATAGCAGG + Intergenic