ID: 960327695

View in Genome Browser
Species Human (GRCh38)
Location 3:116317319-116317341
Sequence GGCTCTCTTTGTATTGTGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960327695_960327698 16 Left 960327695 3:116317319-116317341 CCGGACACAATACAAAGAGAGCC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 960327698 3:116317358-116317380 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960327695 Original CRISPR GGCTCTCTTTGTATTGTGTC CGG (reversed) Intronic
907576591 1:55531702-55531724 GGTTCTCTTTGTCTTGTTTCTGG + Intergenic
911397511 1:97330147-97330169 GATTCACTTTATATTGTGTCAGG - Intronic
914736588 1:150423338-150423360 GGGTTTGCTTGTATTGTGTCAGG + Intronic
915632754 1:157164500-157164522 GGCTCCCTTAGTTTTGTCTCCGG + Intergenic
916567844 1:165997213-165997235 GGCTCTGTTTGTATGATCTCAGG + Intergenic
917513133 1:175684619-175684641 GGGTCTCTTTGGATTGTGGCAGG - Intronic
917938717 1:179894787-179894809 GGCTTACTTTGTGTTTTGTCTGG - Intronic
921775254 1:219090712-219090734 GGCTCTCTATGTCTTGTGATTGG - Intergenic
1065092749 10:22252027-22252049 GGCTCACTTTATTTTGTGTGTGG - Intergenic
1070112313 10:73497485-73497507 TGCTTTCTTTGTATTGGGGCTGG - Intergenic
1076569559 10:131423742-131423764 GGCTCTCTTTGGAATGTGCCGGG + Intergenic
1076828174 10:132980904-132980926 GGTTGACTTTGTATTGTGCCTGG - Intergenic
1077825133 11:5799702-5799724 GTCTCTTTTTGTATTCTTTCAGG - Intronic
1078135268 11:8646682-8646704 GGCTCTCTTTTTTTTGTATTTGG - Intronic
1079301285 11:19281228-19281250 GGCTCTCTTTGTATTTTAATAGG + Intergenic
1083133774 11:60652285-60652307 GGCTTTCTTTGTTTTGTTTTGGG + Intergenic
1087689145 11:101298824-101298846 GGCTATCTATGTTTTGTGACTGG + Intergenic
1088280735 11:108132226-108132248 GACTCGCATTGTATTGTGTGTGG + Intronic
1089129490 11:116200688-116200710 GGTTCGCTTGGTGTTGTGTCTGG + Intergenic
1091148075 11:133298231-133298253 GGCTATCTTTATACTGTGTCTGG - Intronic
1091889928 12:4045260-4045282 GGCTCTCTCTGTCCTTTGTCAGG + Intergenic
1093714839 12:22369526-22369548 GGCTCTCTTTTTCTATTGTCTGG - Intronic
1093995902 12:25642372-25642394 GGCTCTCTCTCTGTTGTGTGAGG + Intronic
1098686071 12:73423590-73423612 GGCTCTCTTTCTCTCTTGTCTGG - Intergenic
1099023996 12:77442950-77442972 GGCCTTCTTTGCATTGTGTTGGG - Intergenic
1099785629 12:87259237-87259259 GACTCTTTCTGTATTGTGTGGGG + Intergenic
1102890787 12:116557248-116557270 GGCTCTCTTTGTATAATGGAAGG - Intergenic
1104219095 12:126764644-126764666 GGCTCTGTTAGTACTGTATCTGG + Intergenic
1105234539 13:18536537-18536559 TGCTCTTTTTCTATTGTGTGAGG - Intergenic
1106771192 13:32962157-32962179 GGCCCTCTCTGTCTTCTGTCAGG - Intergenic
1106785505 13:33104544-33104566 ATCTCCCTTTGTATGGTGTCTGG + Exonic
1107863229 13:44681110-44681132 GGCTAGCTTTGGATTGTGTTGGG - Intergenic
1108597965 13:51965889-51965911 GGCTCTTTTTGTATTTATTCTGG - Intronic
1113437150 13:110302051-110302073 AGCTCTCTTTGCCTTGTGCCAGG - Intronic
1115303632 14:31912936-31912958 GGATCTCTTCATATTGGGTCTGG + Intergenic
1115949898 14:38709432-38709454 GGCTTTCTTTGTATTTTCTAAGG - Intergenic
1119550930 14:75513615-75513637 GTCTCTCTCTGTATGCTGTCAGG + Intergenic
1137741359 16:50778978-50779000 GGCTCTCTTTATCATGTGTTTGG + Intronic
1138494481 16:57399309-57399331 GGCCCTCTTTCTAGAGTGTCAGG + Intergenic
1140263653 16:73401820-73401842 GTCTCTCTTTGAAATGTGTGTGG + Intergenic
1142854748 17:2723493-2723515 GGCTCTCTTCTTCTTGTCTCTGG + Intergenic
1143124095 17:4630471-4630493 GGTTTCCTTTGTAGTGTGTCTGG + Intergenic
1147491054 17:40866843-40866865 GGCTCTCTAGGTATTCTCTCGGG - Exonic
1147645010 17:42028143-42028165 GACTCTCTTGGCTTTGTGTCCGG + Exonic
1159166497 18:64708255-64708277 GGCTCTCTTTTTATTGGGAGAGG - Intergenic
1160095158 18:75864656-75864678 GATTGTCTTTGTAATGTGTCAGG + Intergenic
926615028 2:14988350-14988372 GGGTCTGTTTATATTGTATCTGG - Intergenic
929350276 2:40942329-40942351 AGCTCTTTATGTATTGTATCAGG - Intergenic
929357313 2:41041344-41041366 GGCTCTCTTCCTGTTCTGTCGGG - Intergenic
930920738 2:56750600-56750622 GGCACTGTTTGTGTTGGGTCTGG - Intergenic
931468586 2:62514795-62514817 GTTTTTCTTTGTAATGTGTCTGG + Intergenic
937081947 2:119146569-119146591 GACTCTCTTTGAAGTGTGTTTGG - Intergenic
938515268 2:131998104-131998126 TGCTCTTTTTCTATTGTGTGAGG + Intergenic
939775497 2:146382291-146382313 GGCTATGTTTGTACTGTGTTTGG - Intergenic
1171039175 20:21743781-21743803 TGCTTTCTTTGTATTGTTTGGGG + Intergenic
1175268539 20:57717477-57717499 GGGTCTGTTTGTATTTTGTCCGG - Intergenic
1176416097 21:6475634-6475656 GGCTCTTTTTTTCTTGAGTCAGG + Intergenic
1176778527 21:13164823-13164845 TGCTCTTTTTCTATTGTGTGAGG - Intergenic
1176838244 21:13815074-13815096 GGCTGTCTTTGTGTTATCTCTGG - Intergenic
1178607459 21:34052345-34052367 GTCTCTCTTTCTACTGTGCCTGG - Intergenic
1179377156 21:40860708-40860730 GGCTCTCTTGGTAAAATGTCTGG - Intergenic
1179564257 21:42236566-42236588 GGGTCTCTTTGCATTTGGTCAGG - Intronic
1179691597 21:43083968-43083990 GGCTCTTTTTTTCTTGAGTCAGG + Intergenic
1181035125 22:20166235-20166257 GTCTCTCTTAGTATTGGGGCAGG + Intergenic
1182959347 22:34457361-34457383 TGCTCTCTTTATATTCTTTCTGG - Intergenic
950554869 3:13689314-13689336 GGCCCTCTGTGGAGTGTGTCGGG + Intergenic
952544451 3:34403865-34403887 GGACTTCTTTGTTTTGTGTCAGG + Intergenic
956734209 3:72224681-72224703 GGCGCTCTTTGTTTTTTGTTTGG + Intergenic
956911657 3:73824282-73824304 GCTTCTCTTTTTATTTTGTCAGG - Intergenic
957458906 3:80491981-80492003 GGCTCTCTGTGTATTATCTGTGG - Intergenic
958620728 3:96555950-96555972 GGATGTCTTTGTTTTGTGTAGGG - Intergenic
960327695 3:116317319-116317341 GGCTCTCTTTGTATTGTGTCCGG - Intronic
961004327 3:123394772-123394794 GGCCTGCTTTGTATTGTGGCAGG + Intronic
964105490 3:153035068-153035090 GGCTTGCTGTGTTTTGTGTCCGG - Intergenic
964280796 3:155062366-155062388 GGCTATCTTTTTATTGTCTTTGG + Intronic
964398212 3:156270237-156270259 GGCACTCTATGTATTTTGACTGG + Intronic
964989919 3:162797309-162797331 GGGTTTCTTTGGTTTGTGTCTGG - Intergenic
965509542 3:169553501-169553523 GGCACTCTTTACATTGTGGCAGG + Intronic
972420425 4:38881467-38881489 GGCTCTGGATGTATTGTGTTGGG + Intronic
976704113 4:88004131-88004153 GTCTCTCCTAGTATTGTGCCTGG + Intergenic
977276208 4:94980472-94980494 GCCCCTCTTTGTATGGAGTCTGG + Intronic
982995732 4:162342228-162342250 GGCTCACTGTGAATTGTGACTGG + Intergenic
983542156 4:168923177-168923199 AGCTCACTTTGTATTCTTTCTGG - Intronic
985607101 5:863663-863685 GGCGCTCTGTGTCTTGTGACTGG + Intronic
985776385 5:1846219-1846241 GGCTCTCGTTTTGTCGTGTCTGG + Intergenic
986059315 5:4173048-4173070 GTCTCACTTTGTATTATGTGAGG + Intergenic
987056216 5:14195371-14195393 TGCTCTCTGTGCATTTTGTCAGG + Intronic
987387641 5:17345116-17345138 GGGTTTTTTTGTAGTGTGTCAGG - Intergenic
988402113 5:30775792-30775814 GGCTTTGTTTGTATTGTGAGGGG - Intergenic
992815975 5:80438696-80438718 GGTTCACTTTCTATTGTATCTGG - Exonic
993985321 5:94590333-94590355 GCCTGTCTTTCTATGGTGTCTGG + Intronic
994492669 5:100466822-100466844 GGTTCTCTTTGCATTTTGCCTGG + Intergenic
995491693 5:112699643-112699665 CCCTCTCTTTTTATTTTGTCAGG + Intergenic
996916701 5:128720824-128720846 GGCTCCCTTTGTCTATTGTCTGG + Intronic
998964262 5:147521761-147521783 GGCTTTATGTGTCTTGTGTCTGG - Intergenic
1001345134 5:170888152-170888174 GGCTATTTTGGTATTGTGTTCGG + Intronic
1008205240 6:48647902-48647924 GGGCCTCCTTGTCTTGTGTCAGG - Intergenic
1009755873 6:67939621-67939643 GTCTCTCTCTCTATTTTGTCTGG - Intergenic
1012163495 6:95918622-95918644 GGCTTTCTTTATAATGTGTGTGG + Intergenic
1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG + Intronic
1021557915 7:21940458-21940480 AGCTCTCTTAGCATGGTGTCTGG - Intronic
1026118332 7:67515076-67515098 AGCTCTCTTTCTGTTGTGTGAGG + Intergenic
1029624477 7:101711608-101711630 GGCTCTCTTTATTCTGTCTCAGG - Intergenic
1033509794 7:142048452-142048474 GGCTCTCTTTTTATTGTCAATGG + Intronic
1038707378 8:29907408-29907430 GTCTCTCTCTTTATTCTGTCTGG + Intergenic
1040256392 8:45677172-45677194 AGCCCTCTTTTTATAGTGTCTGG + Intergenic
1040489081 8:47902795-47902817 AGGTCTCTTTGTTTTGTTTCAGG - Exonic
1041859770 8:62499917-62499939 TGCTTTCTTTTTATTATGTCTGG + Intronic
1043185425 8:77142328-77142350 TGCCATCTTTGTATTTTGTCTGG - Intergenic
1043602665 8:81959701-81959723 AGCTTTCTTTGTAATGTGTGTGG - Intergenic
1044624097 8:94219146-94219168 GGCTTTCTCTGTATTTGGTCTGG - Intergenic
1045051699 8:98333274-98333296 GGCTCTCTTTTCATTATATCAGG - Intergenic
1051239795 9:15041538-15041560 GGCTCTTTTTTTACTGTGTGAGG + Intergenic
1051532851 9:18124529-18124551 GGCTCTCTTTTTACTTTGTTGGG + Intergenic
1056333038 9:85537567-85537589 TGCTGTTTTTGTATTGTGTGTGG - Intergenic
1057165578 9:92922681-92922703 GGTTTGCTTTGTAGTGTGTCTGG - Intergenic
1058628527 9:106961061-106961083 GGCTCTATTTGTATGGTCTCAGG + Intronic
1185825248 X:3243330-3243352 GGCTCTCTTTCCATTGTAACTGG - Intergenic
1186098841 X:6132979-6133001 GGTTCTGTTTGTATGGAGTCTGG + Intronic