ID: 960329673

View in Genome Browser
Species Human (GRCh38)
Location 3:116343354-116343376
Sequence ACCCTAGATCTGCCACTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960329669_960329673 13 Left 960329669 3:116343318-116343340 CCCTGAAAGTAGGCAATGCAAAC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 960329673 3:116343354-116343376 ACCCTAGATCTGCCACTGACTGG 0: 1
1: 0
2: 4
3: 40
4: 258
960329670_960329673 12 Left 960329670 3:116343319-116343341 CCTGAAAGTAGGCAATGCAAACA 0: 1
1: 0
2: 0
3: 16
4: 202
Right 960329673 3:116343354-116343376 ACCCTAGATCTGCCACTGACTGG 0: 1
1: 0
2: 4
3: 40
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960329673 Original CRISPR ACCCTAGATCTGCCACTGAC TGG Intronic
900599250 1:3496117-3496139 ACCCTGGGTCTGCCCCAGACAGG + Intronic
901728139 1:11258407-11258429 ACCCTGTGTCTGCCACTTACTGG - Intronic
902159416 1:14518042-14518064 GCCCAAGGTCTGCCACTGACTGG + Intergenic
902556807 1:17251642-17251664 ATCCTGGCTCTGCCACTCACTGG - Intronic
902785716 1:18731426-18731448 ATCCCAGCTCTGCCACTTACCGG + Intronic
902931603 1:19735364-19735386 CTCCTAGCTTTGCCACTGACTGG - Intronic
903011084 1:20330890-20330912 ACCCAACGTCTGCCACAGACTGG + Exonic
903666807 1:25013025-25013047 ATCCCAGCTCTGCCACTTACCGG - Intergenic
903925822 1:26829780-26829802 ACCCTAGTTCTGTCATTGGCTGG + Intronic
904005959 1:27363422-27363444 ACCCTTGCTCTGCCACTCACCGG + Exonic
904280121 1:29413173-29413195 AACCCAGCTCTGCCACTCACAGG - Intergenic
904291637 1:29489844-29489866 ATCCCAGTTCTGCCACTTACTGG + Intergenic
904474478 1:30756096-30756118 ACCCCAGCCCTGCCACTAACTGG - Intronic
904770113 1:32876422-32876444 GGCCTGGAGCTGCCACTGACTGG - Intergenic
904894489 1:33803997-33804019 ATCCCAGTTCTGCCACTTACTGG + Intronic
905586652 1:39124872-39124894 ATCCTGATTCTGCCACTGACTGG - Intronic
905766124 1:40602594-40602616 ACCCTGGCTCTGCCACTTACTGG + Intergenic
905775222 1:40664013-40664035 ACCCAAGCTCTGCCACTTTCTGG - Intronic
906242446 1:44250422-44250444 CCCCAAGATCTTCCACAGACTGG + Intronic
906477380 1:46178774-46178796 ATCCTGGCTCTGCCACTTACAGG + Intronic
906948409 1:50315330-50315352 ACCCTAGTCCTGACCCTGACTGG - Intergenic
907237203 1:53061015-53061037 ACCCCAGCTCTGCCAGTGAATGG + Intergenic
907674066 1:56502586-56502608 ATCCTAGATCTGCCATTGCATGG + Intronic
908124712 1:61018864-61018886 ATCCTGGTTCTGCCACTTACTGG - Intronic
908528370 1:65009800-65009822 ATCCCAGCTCTGCCACTTACTGG - Intergenic
908916956 1:69139247-69139269 AGCCTAGATCTGCCACTGAAGGG - Intergenic
909523983 1:76601675-76601697 ACCCTGGCTTGGCCACTGACTGG - Intronic
910015305 1:82516803-82516825 TCCCTAAATTTGCCACTGCCAGG + Intergenic
911229762 1:95348369-95348391 ACCCTAGATCTCACACTCCCTGG - Intergenic
912823946 1:112888497-112888519 AGCCTGGTTCTACCACTGACTGG - Intergenic
913196897 1:116464562-116464584 ATCCTAGCTCTGCCTCTCACAGG - Intergenic
915129452 1:153686789-153686811 GCCCTGGCTCTGCCCCTGACTGG + Intronic
916185667 1:162130282-162130304 ATCCTAGTTCTGCCACTTACAGG - Intronic
916852089 1:168713975-168713997 ACCATAGAGCCGGCACTGACTGG - Intronic
917525807 1:175787566-175787588 ATCCCAGCTCTACCACTGACTGG - Intergenic
917626312 1:176850070-176850092 ATCCTGGCTCTGCCACTTACTGG - Intergenic
918570711 1:185988721-185988743 ACCCCAGCTCTACCACTGATGGG + Intronic
918974091 1:191458405-191458427 ACCCTAGATCTGCCACATACTGG - Intergenic
919094224 1:193010466-193010488 ATCCTAGATCTACTACTTACTGG + Intergenic
920068989 1:203289192-203289214 ACCTTAGCTCTGCCACTTGCTGG - Intergenic
920586738 1:207171646-207171668 ACCTTGGATCTGACAATGACTGG - Intergenic
920982683 1:210853152-210853174 CCCCTAGCTCTGCCACTTACTGG + Intronic
921123060 1:212153369-212153391 ACCCTAGCTCAACCACTTACTGG + Intergenic
921809317 1:219493785-219493807 AAGCAAGATCTGCCACTGAATGG - Intergenic
922130151 1:222769689-222769711 ATCTTAGATCTGCCACTTGCTGG - Intergenic
922452730 1:225749986-225750008 CTCCTAGCTCTGCCACAGACTGG + Intergenic
1066121539 10:32293329-32293351 ACCCTAGTTCAGTGACTGACAGG - Intronic
1066300531 10:34091823-34091845 ATCCCAGCTTTGCCACTGACCGG - Intergenic
1072706329 10:97683805-97683827 GCCCTACTTCTGCCACTCACTGG + Intronic
1073084760 10:100881025-100881047 ATCCTGGCTCTGCCACTCACTGG - Intergenic
1073204495 10:101761741-101761763 ACCCTGGCTCTGTCACTGCCTGG - Intergenic
1074852746 10:117451822-117451844 TTCCTGGATCTGTCACTGACTGG - Intergenic
1075306732 10:121374637-121374659 ATCCTAGCTCTGCCACTGTGAGG - Intergenic
1075598877 10:123752737-123752759 ATCATAGCTCTGCCACTCACTGG + Intronic
1078873731 11:15373165-15373187 ATCCTAATTCTGCCACTGATTGG - Intergenic
1079099220 11:17530400-17530422 ATCCTGGCTCTGCCACTTACTGG + Intronic
1079116146 11:17641780-17641802 ACCCTGGCTCTCCCACTGCCTGG - Intronic
1079305532 11:19317993-19318015 ATCCTAGCTCTGCCACTTACTGG + Intergenic
1080684058 11:34501100-34501122 CTCCTAGCTCTGCCACTTACGGG - Intronic
1080778982 11:35413317-35413339 AGCCTAGCTTTGCCACTCACTGG + Intronic
1083709671 11:64540445-64540467 ACCCTGGCTCTGCCACTCACCGG - Intergenic
1084687057 11:70702837-70702859 AACCCAGCTCTGCCACTTACTGG + Intronic
1085554471 11:77407476-77407498 AGCCTAGGGTTGCCACTGACAGG - Intronic
1085718983 11:78896793-78896815 ACCCTGGTTCTGCCACTTACTGG + Intronic
1085951454 11:81337394-81337416 TCCCTAGATGTGCTACTTACTGG - Intergenic
1087658815 11:100961259-100961281 ATCCTAGCTCAGCCACTTACAGG + Intronic
1087927034 11:103930587-103930609 ACTCTGGCTCTACCACTGACTGG - Intronic
1088943323 11:114483232-114483254 ACCCCAGCTCTGCCACTCGCTGG + Intergenic
1089364990 11:117915997-117916019 ACCCTGGCTCTGCCACCGACAGG - Intronic
1089459302 11:118643455-118643477 GTCCTAGCTCTGCCACTAACAGG - Intronic
1090416931 11:126547151-126547173 AGCCCAGATCTGCCACTAACTGG - Intronic
1091658075 12:2360309-2360331 CCGCTAGATCTTCCACTGCCCGG + Intronic
1092126341 12:6077527-6077549 AGCCCAGCTCTGCCACTTACTGG + Intronic
1092194147 12:6539075-6539097 CCCCTGGCTCTGCCACTGAACGG + Intronic
1095507593 12:42913986-42914008 AGCCTGGCTCTGGCACTGACTGG - Intergenic
1097262996 12:57729963-57729985 ATCCTGGTTCTGCCACTTACTGG + Intronic
1098916596 12:76263218-76263240 ACTCTAGATCTGCCACTTGCTGG - Intergenic
1099660590 12:85554493-85554515 ACCCTCGCTCTGCCTCTTACTGG + Intergenic
1100079397 12:90829152-90829174 ATCCCAGTTCTGCCACTGACTGG + Intergenic
1101415241 12:104503193-104503215 ACCCCAGATCTGCTGCTGCCTGG + Intronic
1102241116 12:111325489-111325511 ATCCTAGGTCTGCCACTCACTGG - Intronic
1103405885 12:120674950-120674972 ACCCCAGCTCTGCCACTTAAGGG + Intergenic
1103485309 12:121278963-121278985 ATCCTAGAGCTGCCTCTGATAGG + Intronic
1103970988 12:124671315-124671337 ATCCCAGATCTGCCACTCACTGG - Intergenic
1104047603 12:125174122-125174144 ATCCCAGCTCTGCCACTCACTGG - Intergenic
1105542758 13:21328942-21328964 ACCCCAGATTTCACACTGACAGG - Intergenic
1108514703 13:51189457-51189479 ACCCAAGATAGGCCAATGACAGG + Intergenic
1115332902 14:32217328-32217350 ATCCTATCTGTGCCACTGACTGG - Intergenic
1115429207 14:33297173-33297195 ATCCTAGCTCTGCCATTTACTGG + Intronic
1115451805 14:33556690-33556712 ATCCTGGCTCTGCCACTGACTGG + Intronic
1115630853 14:35243681-35243703 AACCTAGTTCTGCTACTTACTGG + Intronic
1115882887 14:37939874-37939896 ACCCTGGCTCTGCCACTCACTGG + Intronic
1118010491 14:61605797-61605819 TCCCTTGATCTGCAACTGCCTGG - Intronic
1121444629 14:93970758-93970780 ACCCTAGCTCTGCCACCTCCTGG + Intronic
1121534419 14:94681507-94681529 ACCCTGGAACTGCCAGTGAGTGG - Intergenic
1121884464 14:97530702-97530724 ATTTTAGATCTGCCACTTACTGG + Intergenic
1124901548 15:33827781-33827803 ATCCTGGTTCTGCCACTTACTGG + Intronic
1125124326 15:36201837-36201859 ACCCAAGCTCTGGCACTTACTGG - Intergenic
1125524475 15:40366480-40366502 GCCCTTGCTCTGCCACTAACTGG - Intronic
1128114635 15:65097516-65097538 ACCCCAGTGCTGCCATTGACTGG + Intronic
1128359874 15:66954469-66954491 ACCCCAGCTCTGCCACCCACCGG - Intergenic
1128581843 15:68816325-68816347 ATCCTGGTTCTGCCACTCACTGG + Intronic
1129202875 15:74015629-74015651 ACCCCAAATCTGACATTGACAGG + Intronic
1129373314 15:75111313-75111335 ACTCCAGCTCTGCCACTCACTGG + Intronic
1129794484 15:78365806-78365828 CTCCTGGCTCTGCCACTGACCGG + Intergenic
1129816972 15:78563993-78564015 ATTCTAGTTTTGCCACTGACAGG + Intergenic
1130011405 15:80155471-80155493 ACCCCATATCTGCCTCTTACTGG - Intronic
1130387315 15:83423190-83423212 AACCTGGATCTGCCACTGTGAGG + Intergenic
1130965872 15:88697236-88697258 AACTTATATCTGCCACTGGCAGG + Intergenic
1133095803 16:3444283-3444305 CCCCAAGCTCTGCCACTGATTGG + Intronic
1133152224 16:3843194-3843216 AGCCTGGTTCTGCCACTCACTGG + Intronic
1134675300 16:16086033-16086055 ACTCTGGATCTGTCACTGTCTGG - Intronic
1134790434 16:16984667-16984689 ACCCCAGTTCTGTCACTCACTGG - Intergenic
1135185828 16:20314993-20315015 ATCCCAGCTCTGCTACTGACTGG - Intronic
1135796170 16:25444952-25444974 ATCCTGGCTCTGCCACTTACTGG - Intergenic
1137688709 16:50404895-50404917 ACCCAAGCTCTGCCACTTGCTGG + Intergenic
1138317355 16:56081557-56081579 ACCCCAGATGTGACTCTGACAGG - Intergenic
1138521120 16:57571365-57571387 GCCCCAGCTCTGCCACTGACTGG - Intronic
1140137659 16:72222089-72222111 ACCCCAACTCTGCCACTTACTGG - Intergenic
1140212314 16:72980155-72980177 GTCCTAGCTCTGCCACTGACCGG - Intronic
1140730489 16:77851802-77851824 AGCCTAGCTATGGCACTGACAGG - Intronic
1141681984 16:85550263-85550285 ACCCCAGCTCTGCCACCCACTGG + Intergenic
1142137720 16:88459345-88459367 ACCACAGCTCTGCCACTTACTGG + Intronic
1142485960 17:247880-247902 CCACTAGATCTGCCAGTGACTGG + Intronic
1142674416 17:1504922-1504944 GCCCCAGCTCTGCCACTCACTGG + Intronic
1142752021 17:1994649-1994671 ATCCCAGCTCCGCCACTGACAGG + Intronic
1143349493 17:6277048-6277070 AGCCTGGCTCTGCCACTGTCTGG + Intergenic
1143944010 17:10573427-10573449 AACCTAGAGCTGCCACGAACTGG - Intergenic
1143997674 17:11021848-11021870 ACCCTACAGCTATCACTGACTGG - Intergenic
1144403261 17:14927245-14927267 ACCCTAGTTCTTCTACTTACTGG + Intergenic
1150493150 17:65588083-65588105 ATCCAAGGGCTGCCACTGACTGG + Intronic
1154224148 18:12486573-12486595 ACCTCAGCTCTGCCACTAACTGG + Intronic
1155254070 18:23979365-23979387 ACCCAAGGCCTGCCACTCACTGG - Intergenic
1157486751 18:48093154-48093176 ACCCTAGTTCGGGCACTGGCAGG - Intronic
1157933034 18:51844096-51844118 ACCACATACCTGCCACTGACTGG - Intergenic
1161793845 19:6375527-6375549 GGCCTAGCTCTGCCACGGACAGG + Exonic
1162922312 19:13910462-13910484 ATCCGAGCTCTGCCACTTACTGG + Intronic
1164003609 19:21129828-21129850 ACCCTAGACCTGAAACTTACTGG - Intergenic
1165773978 19:38394505-38394527 ACCCCGGCTCTGTCACTGACTGG - Intronic
1166554505 19:43689253-43689275 ACCCTAGATCTGGCCCTGGGTGG + Intergenic
1167565765 19:50255679-50255701 ATCCCAGCTCTGCCACTTACTGG - Intronic
924969241 2:109123-109145 ACCTCAGATCTGCCACTGCTGGG + Intergenic
926424696 2:12730306-12730328 ACCCCAGGTCTGCCACTGGTTGG - Intronic
926691566 2:15738116-15738138 ATCCCAGCTCTGCCACTTACTGG + Intronic
926802276 2:16669040-16669062 ATCCTAATTCTGCCACTCACTGG + Intergenic
927963761 2:27256932-27256954 CCCCTAGATCTTCCTCTGAAAGG - Intronic
928266999 2:29820717-29820739 ACCCTGGCTTTGCCACTGACTGG + Intronic
928439535 2:31280452-31280474 ATCCTAGATCTGCCATTTATTGG - Intergenic
929772126 2:44901139-44901161 ACCCTATAGCTGTCACTCACCGG + Intergenic
930009085 2:46921861-46921883 ACCGCTGATCTGACACTGACAGG + Intronic
930084818 2:47488757-47488779 ATCCCAGCTCTGCCACTTACTGG - Intronic
930368675 2:50476365-50476387 ACCCTGGCTCTGCCACCTACTGG + Intronic
934522540 2:95028460-95028482 ACCCTTGGTATGCCACTGGCGGG + Intronic
934766275 2:96881869-96881891 AACCTAAACCTGCCACTGCCTGG + Intronic
934952811 2:98590391-98590413 ATCCTGGTTCTGCCCCTGACTGG + Exonic
935954570 2:108362982-108363004 AGGCTAGATCTGCCACACACAGG - Intergenic
937833666 2:126449698-126449720 ACCCTAGACCACCCACTCACTGG + Intergenic
942120299 2:172770138-172770160 ACCTGAGAGCTGCCACTGGCTGG + Intronic
946931773 2:224678107-224678129 TCCCTGGATTTGCCAGTGACAGG + Intergenic
947459977 2:230295597-230295619 ATCCTGGATCTGCCACTTAAGGG - Intronic
947837469 2:233185984-233186006 GCCATAGCTCTGCCACTGGCTGG - Intronic
948463703 2:238142365-238142387 CCCCCAGATCTCCCACTGCCAGG - Intronic
1168957594 20:1845438-1845460 AATCTAGGTCTGCCACTTACTGG + Intergenic
1170394651 20:15912982-15913004 ATCCCAGCTCTACCACTGACTGG + Intronic
1173011956 20:39191001-39191023 ATCCCAGCTCTGCCACTTACAGG - Intergenic
1173666624 20:44767642-44767664 ATCCCAGCTCAGCCACTGACTGG + Intronic
1174306297 20:49616440-49616462 ACCCTGGCTCTGCCACTTCCTGG - Intergenic
1174457030 20:50656267-50656289 ATCCTAGCTCTGCCACTTGCTGG + Intronic
1177185758 21:17794207-17794229 ATCCTTGATCTGCTACTGATTGG + Intronic
1177898248 21:26880963-26880985 ACCCAGGATCTACCATTGACAGG - Intergenic
1177898317 21:26882117-26882139 ACCCAGGATCTGCCATTGACAGG - Intergenic
1178063946 21:28882946-28882968 CATCTAGATCTTCCACTGACAGG - Intronic
1178796456 21:35748982-35749004 GCCCTGAGTCTGCCACTGACTGG + Intronic
1181623752 22:24108211-24108233 ATCCCAGATCTGCCACTTAGGGG - Intronic
1182549229 22:31092003-31092025 GCCTTAGCTCTGCCACCGACTGG - Intronic
950205516 3:11077170-11077192 ACACTAGCTCTGCCACTGACTGG - Intergenic
950217644 3:11170624-11170646 ATCCTGGCTCTGCCACTGACCGG - Intronic
950657824 3:14447984-14448006 ATCCCAGTTCTGCCACTTACTGG + Intronic
950755550 3:15168511-15168533 ATCCTAGATTTGGCACTTACTGG - Intergenic
950999997 3:17547034-17547056 CACCTAGATCTGCTACTGATTGG - Intronic
951830010 3:26916058-26916080 AGCCTGGCTTTGCCACTGACAGG + Intergenic
952071457 3:29642144-29642166 CCCGTAGATCTGCCAATGAGTGG + Intronic
952506031 3:34007512-34007534 ACCCCAGCTCTGCCACTCACTGG - Intergenic
952818410 3:37465458-37465480 ATCCCAGCTCTGCCACTTACTGG + Intronic
953231706 3:41071118-41071140 ACCCCAGCTCTGCCACTTTCTGG + Intergenic
956425385 3:69129081-69129103 ATCCTGGTTGTGCCACTGACTGG + Intergenic
956923482 3:73956201-73956223 ATTCTAGTTCTGCCACTAACTGG + Intergenic
959475262 3:106803304-106803326 AACCCAGATCTGCCACCCACTGG + Intergenic
960329673 3:116343354-116343376 ACCCTAGATCTGCCACTGACTGG + Intronic
960443070 3:117712983-117713005 CCACTAGAACTGCCACTGAGGGG + Intergenic
960571085 3:119185974-119185996 AGCCTAGCTCTGCCACTTACTGG + Intronic
960987595 3:123290831-123290853 ACCCCAGCTCTGCCACTTATTGG + Intronic
961122170 3:124382064-124382086 ATCCTGGTTCTGCCACTTACTGG + Intronic
961569892 3:127790114-127790136 ATCCTGGATCTGCCCCTGACTGG + Intronic
964047396 3:152345773-152345795 ACCCTAGTTCTGCCGTTTACTGG + Intronic
964345035 3:155746366-155746388 ACCCTAGATCTTGCGCTGAGAGG - Intergenic
967787790 3:193515888-193515910 AGACTAGCTCTGCCACTTACTGG + Intronic
969489372 4:7490496-7490518 ACCCCAGAATTGCCACTGCCAGG + Intronic
969938688 4:10708455-10708477 ACTCCAGCTCTGCCACTGATGGG - Intergenic
970898898 4:21135773-21135795 ACCCAGGCTCTGCCACTTACTGG + Intronic
972290710 4:37687075-37687097 TCCCTAGATCTGCAACCGAGGGG - Intergenic
977621208 4:99139833-99139855 GCCCCAGCTCTGCCACTTACTGG - Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978061264 4:104343477-104343499 ACCCTTGTTCTGCAACTGTCTGG + Intergenic
981943864 4:150317763-150317785 ATCCTACTTCTGCCACTGACTGG + Intronic
982058857 4:151582503-151582525 AACCAGAATCTGCCACTGACAGG - Intronic
982126771 4:152190541-152190563 ACCCAAGACCCACCACTGACTGG - Intergenic
982600523 4:157443570-157443592 AACACAGAACTGCCACTGACTGG + Intergenic
983003021 4:162443381-162443403 ACCCGAGATCTGCCACTAATTGG + Intergenic
983420492 4:167509315-167509337 ACCCTGCATTTGCCACTCACTGG + Intergenic
984193041 4:176627077-176627099 ATCCTAGATCTGCCTCTTATTGG + Intergenic
984913705 4:184700486-184700508 ACCCAAGCTCTGCCACTTACTGG - Intronic
985925655 5:3014609-3014631 GCTCTAGATCAGGCACTGACTGG - Intergenic
986698377 5:10378398-10378420 ATCCTGGTTCTGCCACTAACTGG - Intronic
987220525 5:15786365-15786387 AACCTAGGTCTACCACTGCCTGG + Intronic
990305584 5:54491639-54491661 ACCCTAGTTCTGTCTCTTACTGG - Intergenic
991411021 5:66345909-66345931 ATCCCAGCTCTGCCACTTACAGG + Intergenic
995458154 5:112373656-112373678 ACCCTGGCTCTGCCACTTGCTGG - Intronic
995625599 5:114072718-114072740 ATCCTGGATCTACCACTAACTGG + Intergenic
995815720 5:116165919-116165941 ACCCTTTATCTGCCCCTGAGAGG + Intronic
997589686 5:135065117-135065139 GCCCTGGCTCTGCCACTGACTGG + Intronic
999175152 5:149626951-149626973 ATCCTAACTCTGCCACTGAAGGG - Intronic
999345058 5:150810604-150810626 GTCCTGGATCTGCCACTTACTGG - Intergenic
999472142 5:151864475-151864497 GTCCTAGCTCTGCCACTCACTGG - Intronic
1001082864 5:168679830-168679852 ATCCTAGCTCTGCCACTTACTGG + Intronic
1001245926 5:170105894-170105916 ACCCCGGAGCTGCCCCTGACAGG - Exonic
1001525003 5:172422603-172422625 GCCTTAGCTCTGCCAATGACTGG + Intronic
1001593499 5:172882530-172882552 ATCCTAGCTCTGCCACTCACTGG + Intronic
1003378520 6:5601621-5601643 ACCTTGGCTCTGCCACTTACTGG + Intronic
1003826715 6:9960936-9960958 ATTCTAGATCTGCCACTGTCTGG + Intronic
1004174086 6:13323862-13323884 ATCCTAGCTCTGCCACTTACAGG + Intronic
1004612336 6:17255300-17255322 ATCCTAGCTCTGCCTCTTACTGG - Intergenic
1006396292 6:33789433-33789455 ACCCTAGCTCTGCCTCTGGCAGG + Intergenic
1007146476 6:39638965-39638987 ACTCTAGATCAGCTACTTACAGG + Intronic
1007398186 6:41589148-41589170 ATCCCAGCTCTGCCACTCACAGG - Intronic
1010128462 6:72463313-72463335 CACCTAGAGATGCCACTGACAGG - Intergenic
1013395605 6:109735945-109735967 ACCCTAGATGAGGCACTGAGTGG - Intronic
1014798512 6:125751183-125751205 GCCCTAAATATGCCACTGATAGG - Intronic
1016269746 6:142274778-142274800 GACTTAGATCTGCCACTTACAGG - Intergenic
1016339837 6:143050698-143050720 ATCTTAGCTCTGCCATTGACAGG + Intergenic
1018668388 6:166160529-166160551 ATCCTGGTTCTGCCACTTACTGG - Intronic
1018991581 6:168677796-168677818 ACCCTAGACCTGAAACTTACTGG - Intergenic
1019818288 7:3217667-3217689 AATCCAGCTCTGCCACTGACTGG + Intergenic
1021846844 7:24771541-24771563 ATCCTGGTTCTGCCACTTACTGG + Intergenic
1021895559 7:25231956-25231978 ACCCTGGTTCTGACACTTACTGG - Intergenic
1022412950 7:30153538-30153560 ATCCTGGCTCTGCCACTTACTGG + Intronic
1024499701 7:50091894-50091916 ATCCTAATTCTGCCACTTACTGG + Intronic
1026003298 7:66580426-66580448 ACCCCAGCTCTGCCACGTACTGG + Intergenic
1026028241 7:66765236-66765258 ACCCCAGCTCTGCCACGTACTGG - Intronic
1026984544 7:74546632-74546654 ACCCGATCTCTGCCACTGAGTGG - Intronic
1028099641 7:86804274-86804296 ATTCTAGATCTGCCACTGCATGG + Intronic
1029090007 7:98040681-98040703 ACCCTAGATCTCCCAAGGAAAGG + Intergenic
1030511388 7:110486705-110486727 AGTCTAGTTCTGCCACTTACTGG + Intergenic
1032222160 7:130002594-130002616 GTCCTAGCTCTGCCACTCACTGG + Intergenic
1032402339 7:131632474-131632496 ATGCCAGTTCTGCCACTGACTGG - Intergenic
1036414650 8:8535755-8535777 ATCCCAGATCTGCCATTTACTGG - Intergenic
1037389944 8:18382875-18382897 AGCCTAGCTCTGACAATGACAGG + Intergenic
1037750103 8:21676065-21676087 ATCCCAGATCTGCCACTAACTGG + Intergenic
1037785221 8:21898932-21898954 ATCCCAGGTCTGCCACTAACTGG - Intergenic
1038494826 8:27993960-27993982 ATACTAGCTCTGCCACTTACTGG - Intergenic
1038793098 8:30686050-30686072 ATCCTAGCTCTGCAACTTACCGG + Intronic
1040385243 8:46910929-46910951 ACCCTAGCTCTGTCACACACTGG - Intergenic
1041694731 8:60723973-60723995 ACCTCCGCTCTGCCACTGACTGG + Intronic
1046135532 8:110021217-110021239 ACTCCAACTCTGCCACTGACTGG + Intergenic
1046740271 8:117820275-117820297 ATCCCAGATCTACCACTTACTGG + Intronic
1047765144 8:127984393-127984415 ATCCTAGCTCTGCCACTTGCTGG - Intergenic
1048186644 8:132248037-132248059 ATCCTAGCTCTGCCACTTCCTGG - Intronic
1048333492 8:133486635-133486657 ACCCCAGTCCTGCCATTGACAGG - Intronic
1048335479 8:133499115-133499137 ATCCCAGCTCTGCCACTTACCGG + Exonic
1049007340 8:139863808-139863830 AAAATAGATCTGCCACTGAGGGG + Intronic
1050309339 9:4336626-4336648 ACCCTAGTTCTGTCGCTTACTGG - Intronic
1050336765 9:4597132-4597154 ATCCTAGTTCTGCCATTTACAGG - Intronic
1052742103 9:32403172-32403194 AACCTAGCTCTGCCTCTTACTGG + Intronic
1055053388 9:72001426-72001448 AACCTAGTGCTGCCACTGATAGG + Intergenic
1057005778 9:91557450-91557472 TCCCTACATCTGCCAGCGACTGG + Intergenic
1057574767 9:96233331-96233353 ACGCCAGCTCTGCCACTCACTGG + Intergenic
1058648797 9:107155598-107155620 ACCCCAGATCTGCCACCTACTGG + Intergenic
1058888789 9:109343295-109343317 AGCCTAGCTCTGTCGCTGACTGG - Intergenic
1058911264 9:109522001-109522023 ATTCCAGCTCTGCCACTGACAGG - Intergenic
1058951550 9:109908424-109908446 ATCCCAGCTCTGCCACTTACTGG + Intronic
1059321419 9:113473335-113473357 ACCCCAGCTCTGCCACTTACTGG + Intronic
1059457013 9:114406181-114406203 ATCCCGGCTCTGCCACTGACTGG - Intronic
1059739219 9:117133372-117133394 ATCCTAGCTCTGCCACTGACTGG - Intronic
1060006336 9:120003341-120003363 CCCCTAGAAATGCCACTGACTGG + Intergenic
1061518168 9:131101711-131101733 ATCCCAGATCTGCCACTTCCTGG - Intronic
1061906306 9:133701071-133701093 ACCATAACTCTGCCACTGCCTGG - Intronic
1186370904 X:8946460-8946482 ACCCTAGATCTGGGACTTTCAGG - Intergenic
1188247924 X:27856624-27856646 ACCCAAGATCTGCCTCAGGCTGG - Intergenic
1191678148 X:63813302-63813324 ATCCCAGATCTGCCACTTACTGG + Intergenic
1192537378 X:71939634-71939656 ATTCCAGATCTGCCACTGATTGG + Intergenic
1194650428 X:96508087-96508109 ACCCCAACTCTGCCACTTACTGG - Intergenic
1195935629 X:110123494-110123516 AACCAAGATCTGCCAATCACTGG - Intronic
1196282772 X:113842612-113842634 ATCCCAGCTCTGCCACTTACTGG + Intergenic
1197772033 X:130095219-130095241 ACCCCGGCTCTGCCACTTACTGG - Intronic
1198032201 X:132764274-132764296 ACTCTGGCTCTGCCACTGACTGG - Intronic
1198816259 X:140594266-140594288 AGCCTGGCTCTGCCACTCACTGG - Intergenic
1198854529 X:141002520-141002542 ACCCTAGGGCTGCCATTGGCTGG + Intergenic
1198877488 X:141242609-141242631 ACCCTAGGGCTGCCATTGGCTGG - Intergenic
1198908171 X:141584830-141584852 ACCCTAGGGCTGCCATTGGCTGG - Exonic
1198908620 X:141589594-141589616 ACCCTAGGGCTGCCATTGGCTGG + Exonic
1198918450 X:141698557-141698579 ACCCTAGGGCTGCCATTGGCTGG - Exonic
1199094196 X:143720844-143720866 ACCCTAGGACTGCCATTGGCTGG - Exonic
1199214145 X:145247389-145247411 ACCCTAGGACTGCCATTGGCTGG + Exonic