ID: 960330779

View in Genome Browser
Species Human (GRCh38)
Location 3:116357966-116357988
Sequence CCAAGTTTCCTAAAGTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960330779_960330782 6 Left 960330779 3:116357966-116357988 CCAGGAAACTTTAGGAAACTTGG 0: 1
1: 0
2: 3
3: 18
4: 169
Right 960330782 3:116357995-116358017 AAACTCATGAAGAATCTCTTTGG 0: 1
1: 0
2: 1
3: 23
4: 246
960330779_960330783 7 Left 960330779 3:116357966-116357988 CCAGGAAACTTTAGGAAACTTGG 0: 1
1: 0
2: 3
3: 18
4: 169
Right 960330783 3:116357996-116358018 AACTCATGAAGAATCTCTTTGGG 0: 1
1: 0
2: 1
3: 9
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960330779 Original CRISPR CCAAGTTTCCTAAAGTTTCC TGG (reversed) Intronic
903432049 1:23312255-23312277 ACAAGTTTACAAAAGCTTCCTGG + Intronic
905394447 1:37657974-37657996 GCAAGTTTCCGAAACTTTCTGGG + Intergenic
906255923 1:44350110-44350132 CCCATTTTCCTAAGCTTTCCAGG - Intronic
906581322 1:46937314-46937336 CCATGGTTCCTACAGATTCCTGG - Exonic
907758664 1:57336445-57336467 CCAAGTATGCTAATGTTACCAGG + Intronic
909801126 1:79808691-79808713 CCGAGTTTAGTAAAGTTTCAGGG - Intergenic
910418713 1:87031357-87031379 ACATGTTTTCTAAAGTTTTCTGG + Intronic
915926053 1:160020459-160020481 CCAACTTTCCTAAAGTAACCTGG - Intergenic
916313795 1:163425666-163425688 TAAAGATTCCTAAAGATTCCTGG + Intergenic
916362641 1:163988404-163988426 CCAAGTCTTCTAATTTTTCCTGG - Intergenic
918334599 1:183496069-183496091 GCAAGTTTCCTAAAATCTCTAGG + Intronic
918898139 1:190374890-190374912 CCTTGTTTCCAAAATTTTCCTGG - Intronic
924118072 1:240767351-240767373 CCAAGTTTCCAGCAGTCTCCTGG - Intergenic
1063881511 10:10537315-10537337 CCCAGTTTTCTAAATATTCCTGG - Intergenic
1066704910 10:38166740-38166762 CCAAGCTTCCTCCAGTTTCCTGG + Intergenic
1066985647 10:42464426-42464448 CCAAGCTTCCTCCAGTTTCCTGG - Intergenic
1067390135 10:45856202-45856224 CCAAGCTTCCTCCAGTTTCCTGG - Intergenic
1067501334 10:46807656-46807678 CCAAGCTTCCTCCAGTTTCCTGG + Intergenic
1067593243 10:47532248-47532270 CCAAGCTTCCTCCAGTTTCCTGG - Intronic
1067640355 10:48040358-48040380 CCAAGCTTCCTCCAGTTTCCTGG - Intergenic
1067873139 10:49979863-49979885 CCAAGCTTCCTCCAGTTTCCTGG + Intergenic
1070137313 10:73706391-73706413 CCAAGCTTCCTCCAGTTTCCTGG - Intergenic
1071828029 10:89344749-89344771 CCAAGTTTGATAAAGTTCCAAGG + Intronic
1072138445 10:92569524-92569546 TAAAGATTCCTAAAGTTTCTTGG - Intronic
1072235058 10:93446557-93446579 CCCAGTGTCTTTAAGTTTCCTGG - Intronic
1072250909 10:93581708-93581730 GCAAGTTTCCTAAACTCCCCGGG - Intronic
1072324055 10:94279221-94279243 TCAAGTTTCCTAAAGTTTCTAGG + Intronic
1078139933 11:8684722-8684744 CCAACTTTCCCAAAGTAGCCTGG - Exonic
1079513694 11:21241172-21241194 TAATGTTTCCTAAAGTCTCCTGG - Intronic
1079640272 11:22796299-22796321 CCACATTTTCTATAGTTTCCAGG + Intronic
1080902382 11:36508870-36508892 CTAAGTGTCCAAAAGTTTACCGG + Intronic
1081048337 11:38305332-38305354 CCAAATTTAATAAAGATTCCAGG - Intergenic
1082195487 11:49299209-49299231 CCAATTTTCCTCAAGTATCAAGG + Intergenic
1082222620 11:49658561-49658583 CCAAGTTTCCTAAAATTTCTGGG + Intergenic
1085318818 11:75562171-75562193 CCAACTTTCCAGAAGTTTCTCGG + Intronic
1085332605 11:75666830-75666852 GCAAGTTTCCTAACCTTTCTGGG - Intronic
1086593673 11:88545285-88545307 CCAATTTTCTTGCAGTTTCCTGG + Intronic
1086626427 11:88960641-88960663 CCAAGTTTCCTAAAATTTCTGGG - Intronic
1086660449 11:89410343-89410365 CCAATTTTCCTCAAGTATCAAGG - Intronic
1088111041 11:106261758-106261780 CAAAGTTTCCTCAAGTTTGTTGG + Intergenic
1089760947 11:120722779-120722801 CCAAGTGTCCTCAGGTTTCAGGG + Intronic
1089967022 11:122661817-122661839 GCAAGTCTCCTGAACTTTCCAGG + Intronic
1092197375 12:6557400-6557422 CCAAGCTTCCTCCAGCTTCCAGG - Exonic
1093402914 12:18768158-18768180 ACAAGTTTCCTAAAGTACCCAGG + Intergenic
1096039091 12:48498829-48498851 ACAAGTTTCCTAAATTTTAAGGG + Intergenic
1100214203 12:92430833-92430855 CCAAGTTACCTAATCTCTCCAGG + Exonic
1101419627 12:104539595-104539617 CCAAGGGTCCTAACGTGTCCTGG - Intronic
1106734684 13:32577302-32577324 CCAACTTTCCCACATTTTCCTGG - Intergenic
1109029716 13:57177353-57177375 CCAATATTCCTCAGGTTTCCTGG + Intergenic
1109125072 13:58506622-58506644 ACAAGTTTTCAAAAGTTTCTGGG + Intergenic
1111547480 13:89760822-89760844 CCAAGGCTGCTGAAGTTTCCAGG - Intergenic
1114929489 14:27449848-27449870 CCAAGTTTCCTAGACTTTGGGGG - Intergenic
1117145292 14:52831178-52831200 CCTAGATTCCAAAATTTTCCTGG + Intergenic
1118179088 14:63473106-63473128 CAAAGATTACTAATGTTTCCAGG + Intronic
1119418542 14:74492913-74492935 TGAAGTTTCCTAAAGTTTGTAGG - Intronic
1120649600 14:87115888-87115910 CCAAGTTTTCTGAAGTTTGAAGG - Intergenic
1122091105 14:99341142-99341164 CCAAGATTCCTCAGGTTTCTAGG - Intergenic
1126550653 15:49925498-49925520 CAAAGTTCCCTAAGGTTCCCTGG + Intronic
1130386702 15:83418255-83418277 CCAGCTTTCCTATAGGTTCCTGG - Intergenic
1131583700 15:93671312-93671334 CCCACTTTTCTAAAATTTCCAGG + Intergenic
1132343417 15:101092228-101092250 CAAAGTTTCCTAACTTTTCAGGG - Intergenic
1135236848 16:20764842-20764864 CTGTGTTTCCCAAAGTTTCCTGG - Intronic
1135350851 16:21727830-21727852 CCAAACTTCTTAAAGATTCCAGG - Intronic
1135682920 16:24473672-24473694 ACAAGTTGCCTAAAGTCTCTTGG + Intergenic
1136547374 16:30963329-30963351 TCAAGTTTCCTACAATTTCTTGG - Intronic
1137465091 16:48700473-48700495 CCAAGGTTCCTGAAGTGTCTGGG - Intergenic
1138874065 16:60927904-60927926 CCTACTCTCCCAAAGTTTCCTGG + Intergenic
1140988721 16:80186875-80186897 CTATGTTTCCTAAAGTTTGAGGG + Intergenic
1142119780 16:88381545-88381567 GCGGGTTTCCTAAAGTTTCAAGG - Intergenic
1142215570 16:88828094-88828116 CAAAGCTTCCTGAACTTTCCTGG - Intronic
1143910944 17:10248486-10248508 CCAAGTGCCCTAATGTTTTCAGG - Intergenic
1146017408 17:29245026-29245048 TCAAGTGTCCTGAAGTTTCTGGG + Intergenic
1146837942 17:36127235-36127257 CCACTTTTCCTAAAGGTACCAGG + Intergenic
1147032984 17:37656250-37656272 CCAAGGTTCCCAAACTTTCTTGG + Intergenic
1147341015 17:39753406-39753428 CCAATTTCCCAAAAGATTCCAGG + Intergenic
1149829373 17:59857881-59857903 CGAAGTTTCCTCATGTTGCCTGG - Intergenic
1155072133 18:22325708-22325730 TCAAGTTTCATTCAGTTTCCTGG - Intergenic
1155801933 18:30116521-30116543 CCAAGTTGCCTATTGTGTCCGGG - Intergenic
1157220047 18:45822954-45822976 CCAAGTTCCCTAAAGTCTAGAGG + Intergenic
1157860719 18:51138059-51138081 CCTAGTTTCCTAAAGCTCCCGGG - Intergenic
1159160357 18:64636904-64636926 CCCTGTCCCCTAAAGTTTCCTGG + Intergenic
1164544730 19:29150819-29150841 CCAAGTTCCCTTAAGTGGCCAGG - Intergenic
1166048419 19:40243177-40243199 CCAATTTCCCTAAAGTGACCTGG + Intronic
1166064986 19:40352450-40352472 CCAAGCTGCCTCAAGCTTCCAGG - Intronic
925189735 2:1873153-1873175 CCAGGTTTTCAAATGTTTCCAGG + Intronic
925601488 2:5612544-5612566 CCAAGATTACTATAGTTTTCTGG - Intergenic
926863516 2:17334348-17334370 CCCAGATTCCTGAAGTCTCCAGG - Intergenic
932771669 2:74503813-74503835 CAAAGCTTCCAAACGTTTCCAGG - Intergenic
936676834 2:114725460-114725482 CCATCTTCCCCAAAGTTTCCAGG + Intronic
937503892 2:122514512-122514534 CCAAGTTCCCTAGGGTGTCCTGG + Intergenic
937672326 2:124551265-124551287 GTCAGTTTCCTAAATTTTCCAGG - Intronic
940403859 2:153278227-153278249 TTAAGTTTCTTAAAGTTTCAGGG + Intergenic
941924008 2:170878129-170878151 CCAAGTTTCCTAAGCATCCCAGG + Intergenic
942483170 2:176411355-176411377 CCATGTTTCCTAAACCTGCCTGG + Intergenic
942887109 2:180939122-180939144 CCAACTTTCCCAAAGTAACCTGG + Intergenic
943601763 2:189930139-189930161 AAAAGTTTCCTAAAAATTCCTGG - Intronic
944296157 2:198065227-198065249 AGAAGTTTCCTAAAGTATTCTGG - Intronic
948819546 2:240533081-240533103 CTAAGTTTCATACATTTTCCTGG + Intronic
1170900020 20:20453498-20453520 CCAAGTTTCTTGATGGTTCCAGG + Intronic
1173172370 20:40737766-40737788 GCAAGAGTCCTAAAGTTTCAGGG + Intergenic
1173514083 20:43652670-43652692 CCAACTTTCCCAAAGTAACCTGG - Intergenic
1173550132 20:43927241-43927263 CCCACTTTCCTCAGGTTTCCAGG + Intronic
1173790290 20:45823851-45823873 CCAAGTTCCCCATAGTCTCCTGG - Intronic
1174963788 20:55187688-55187710 CCAGTGTTCCTAAAGTTTCTAGG + Intergenic
1175481202 20:59312467-59312489 CCAAGTATCCTTAAGTGTGCAGG + Intronic
1176590705 21:8647520-8647542 CCATTTTTCCAAATGTTTCCAGG + Intergenic
1178810165 21:35874284-35874306 CCAAAATTCCTAAAGCTTTCAGG + Intronic
1179639360 21:42737001-42737023 CCAAGCTTCCTAAAATGTCTGGG - Intronic
1180273534 22:10624554-10624576 CCATTTTTCCAAATGTTTCCAGG + Intergenic
1181049855 22:20233330-20233352 CCATGTTTCCCGAGGTTTCCCGG - Intergenic
1182447381 22:30397523-30397545 CCAAGTTTCCTCCCATTTCCGGG + Intronic
1182805841 22:33069524-33069546 CCAAGTTACTTACAATTTCCAGG + Intergenic
949136562 3:574160-574182 CCATTTTTCCTAATGTTTCCAGG - Intergenic
950462332 3:13132809-13132831 CTGTGTTTCCTAAAGTTTCCTGG - Intergenic
950504698 3:13387501-13387523 CCATGTTTCCATAACTTTCCAGG + Intronic
950586665 3:13897071-13897093 CCAAGTTCCCTAAAGCATCCCGG - Intergenic
952030729 3:29139403-29139425 CCAAGTGACATAAAGTTTCTTGG + Intergenic
954076674 3:48187229-48187251 CCAACTTTCAGAAAGCTTCCTGG - Intronic
954403872 3:50334299-50334321 CCAAGTATCCAAAGGTCTCCTGG + Intronic
955999500 3:64713915-64713937 GTAAGTTGCCTAAAATTTCCAGG + Intergenic
957060966 3:75481065-75481087 CCTAGTTTCCTGCAGTCTCCTGG - Intergenic
958644399 3:96851179-96851201 GTAAGTTTCCTAATCTTTCCAGG + Intronic
958795944 3:98706454-98706476 CCCAGTTTCCTCAAGAATCCTGG - Intergenic
959434840 3:106301860-106301882 ACAAGGATCCTAAAGTCTCCTGG - Intergenic
960330779 3:116357966-116357988 CCAAGTTTCCTAAAGTTTCCTGG - Intronic
960513558 3:118578342-118578364 CCAAGGTTCAGAAAGCTTCCTGG - Intergenic
963500094 3:146114956-146114978 CCAAGTTTTCTACAGAATCCTGG - Intronic
965542755 3:169886881-169886903 CAGAGATTCCTAAAGTGTCCTGG - Intergenic
966220398 3:177545629-177545651 TCAAGTTACCAAAATTTTCCTGG - Intergenic
966557074 3:181274583-181274605 CGCAGTTTCCAAAATTTTCCGGG + Intergenic
969109863 4:4837603-4837625 CCAAGATTGCTAAAGCTACCAGG - Intergenic
969833190 4:9815516-9815538 CCAAGATCCTTAAAGTTCCCTGG + Intronic
970344125 4:15136691-15136713 CCAACTTTCCCACATTTTCCTGG + Intergenic
976327867 4:83793363-83793385 GCAAATTTCATAAGGTTTCCTGG + Intergenic
978401632 4:108337166-108337188 CCAACTTTCTTTGAGTTTCCAGG + Intergenic
979229420 4:118329906-118329928 GCAATTTTCTCAAAGTTTCCCGG - Intronic
981295799 4:143129716-143129738 CCAAGTTTTCTACAGAATCCTGG - Intergenic
983650766 4:170034307-170034329 CCAAGTTTCCTAAAGGCATCTGG - Intergenic
983704926 4:170645576-170645598 CCAAACCTCTTAAAGTTTCCAGG + Intergenic
983868407 4:172796110-172796132 TCCAGTTTCCTATATTTTCCAGG + Intronic
983875781 4:172873099-172873121 CCAAGATTCATAAACTTTCTTGG + Intronic
984531965 4:180927294-180927316 CCAATTCTCCTAAAGTTTTTAGG - Intergenic
989183810 5:38603727-38603749 CCTAGTTTTCTAATGTCTCCAGG + Intronic
989792169 5:45419063-45419085 CCAAGTTCCTGAAAGTGTCCAGG - Intronic
992263111 5:74990467-74990489 CCAACTTTCCCAAAGTAGCCTGG + Intergenic
993029553 5:82689584-82689606 ACAAGTTTCCTAATCTCTCCAGG - Intergenic
993215683 5:85020285-85020307 CCAAATCACCAAAAGTTTCCTGG - Intergenic
995759652 5:115549858-115549880 CCAAGTTTCCCAAATTTACCTGG + Intergenic
996262341 5:121488450-121488472 CCAATTGTCCTAAAGTTTGTAGG + Intergenic
998658403 5:144207265-144207287 CCAAGTTTCGGAGAGTTCCCCGG + Exonic
1003693035 6:8373748-8373770 CCTAGTCTCCTAAATTTTCAGGG - Intergenic
1004303451 6:14478863-14478885 CTAAGTTTCATAAAGATACCTGG + Intergenic
1004703362 6:18099965-18099987 CCAAGTTACTTAATCTTTCCAGG + Intergenic
1007699201 6:43756477-43756499 GCAAGTTACCTAAACTCTCCTGG + Intergenic
1008436198 6:51479281-51479303 CAAAGTTCCCCAAAGTTTCATGG + Intergenic
1008568639 6:52793482-52793504 CCAGGTTTCCTACAGATCCCAGG - Intronic
1008660132 6:53659380-53659402 CCAAGTTTTCTGAACTTTCGGGG - Intronic
1008866111 6:56212017-56212039 CCAAATTTCTTAAACTTTCCAGG - Intronic
1009038436 6:58147159-58147181 TGAAGTTTCCAAAATTTTCCAGG - Intergenic
1009214226 6:60900811-60900833 TAAAGTTTCCAAAATTTTCCAGG - Intergenic
1015603887 6:134936448-134936470 ACAAGTCTCCCACAGTTTCCTGG + Intronic
1016500177 6:144711879-144711901 GCAAGTTTGCTAATGTTTCTTGG - Intronic
1017132386 6:151118845-151118867 CCAAGGTTCCTGAAGAATCCTGG + Intergenic
1017337793 6:153282564-153282586 CCAACTTTCCCAAAGTAGCCTGG + Intergenic
1018187860 6:161283207-161283229 CCATCTTTTCTAAAGTTTGCTGG - Intergenic
1020824431 7:13009657-13009679 CCAAATTTCCTAGAATCTCCTGG + Intergenic
1021105489 7:16634472-16634494 CCAAGTTGGCTTAAGTTCCCAGG + Intronic
1022060650 7:26790674-26790696 CTAAGTTTTTTAAAGTATCCGGG + Intronic
1024586185 7:50844043-50844065 TCAAGTTCTCCAAAGTTTCCAGG - Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1026949776 7:74339224-74339246 GCAAGTGTCCTAAACTTTCTGGG + Intronic
1030908833 7:115221106-115221128 TCAAGTTTTTTAAACTTTCCAGG - Intergenic
1031204156 7:118732992-118733014 TCAAGTATCCTGCAGTTTCCTGG + Intergenic
1033284149 7:140026433-140026455 CCAAAATTCCAAAAGTGTCCTGG + Intronic
1037619822 8:20553876-20553898 CTTTGTTTCCTAAAGTATCCAGG + Intergenic
1038625078 8:29184514-29184536 ACAAGTTTCTTAAGCTTTCCAGG - Intronic
1039707769 8:40024713-40024735 ACATGTTTCCTAAACTTTCAGGG + Intergenic
1044166355 8:88988848-88988870 TCAAGCTTCCTAAACTCTCCAGG + Intergenic
1046016223 8:108608637-108608659 ACAAGTTTCCTCAAGGTTCTGGG - Intronic
1047899306 8:129402672-129402694 CCAGTTTTCCTAATGATTCCTGG + Intergenic
1048362056 8:133705934-133705956 CCATGTACCCAAAAGTTTCCTGG - Intergenic
1051505744 9:17825697-17825719 CCTATTTTCCTTATGTTTCCTGG - Intergenic
1055023748 9:71697162-71697184 CCCATTTTCCACAAGTTTCCAGG + Intronic
1055815204 9:80196778-80196800 CCCAGTTTCCCAAAGTTCCCTGG + Intergenic
1056151792 9:83797819-83797841 CCCAGTGGCCTAAAGTTTACTGG - Intronic
1185659665 X:1717267-1717289 CCAAGTTTTCTAAGGTTTCAAGG + Intergenic
1187734903 X:22293451-22293473 CCAAGTTTCCTAACTTCTCTGGG - Intergenic
1188623914 X:32260795-32260817 CAAAGCTTCCTAATGTTTACAGG + Intronic
1188757623 X:33983603-33983625 CCATGTTGCCTAAATTGTCCTGG - Intergenic
1188957110 X:36446648-36446670 GCAAATTTCCTGAAGTTTCTGGG - Intergenic
1200662278 Y:5973827-5973849 CCAGGCTTGATAAAGTTTCCTGG - Intergenic